GenePrediction:GLEAN_2587 Details

Name: GLEAN_2587
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2024363..2027134 (+ strand)
Length: 2772
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2024363..2024485 (+ strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_140:2024556..2024804 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_140:2024873..2025019 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_140:2025077..2025453 (+ strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_140:2025523..2025817 (+ strand)
Length: 295
Type: CDS
Source: GLEAN
Position: GCSC_140:2025869..2027134 (+ strand)
Length: 1266
>GLEAN_2587 class=GenePrediction position=GCSC_140:2024363..2027134 (+ strand)
ATGGAATTCTTCAAGTCCGCGGTCGCATCGGCCATCGCCAAAGGATCGGCATTTCCTTATTCATTTGGCGACCGCGTCGA
TCTCGATCCATCAATATGGACCTTATACAACGGAACTCGTCGAGTACGTTCCTTGCCAGCCGTCCACTACCCAGCCGTTG
TATTGTCTGGGACTTCCAGCTGACACCCACCAGGAAGACGGTTCCGACTGCAGCATCTTCTCCTTCGACATCACCGCAAA
TAAGGCACGTCTGCCATTGGCGCGCAATGCGCTCAAGAAGCTTCGAACCCTGCGACATCCCGGCGTGATCAAGGTGCTGG
ACACTTCCGAAACAGACACATACATATACATTGCAACCGAACGCATTGTTCCGCTCAGATGGCACCTGAAGCGAAAGAGC
GTGAGCCCGGAAACGCTGAAATGGGGGTTGTTCAACATCGCGGTACGGACCTCTCGGCCCTTCTCCATCGACGGGGAGCG
CTCCTGAACCTATACTGACAACGACCGAAGAGAACCATAAAATTCATCAATGATGAGGCATCGTCAGTTCACGGCAGTCT
GAAAGTCTCGTCTGTCTTCACATCCGAAAGCGGCGAGTGGAAGCTCGGTGGCTTTGAGGTGTTGAGCAATGTCAAAGATG
ACGAGGCCGTTATCTATGTACGCTGCCATCTGCTAAGCCATGCTCACACTCTCTTTTCTAACACTGTCGTCTAGAATCTA
GGGAGCTTGGTGCCTGACGCAGGCAGATATACACCCCCGGAGCTTGTGAGGAATGGGTGGGAGGCGATTAAGCGCTGCAA
CCACTCGGCCGTGGACTCTTTCAACTTCGGCATCTTGCTATACGAAGCTTTCAACAACGGCGATTACACTGGGACCGACC
AGGCTGGCCAAACCAAGGGCATCCCACCCACGATGCAGACCGGCTACAAGAGGCTCGTGAACGCCAATCCCAAAGCGCGA
ATAACTGTTGGCAACTTCCTCGAATTAGGACAGCGAAGCGGTGCCTTTTTCGATTCGCCTCTAATCAAGTTGACGGATGG
AATTGAAAACCTCGGGGTCAAGTCCGAAACAGAGCGGGAACAGTTCTTGGAGTACGAGCCAGCCCCATCTCTTGTTCCCT
GCAACCTGCTGTTTCCGTGTCGCATGCTTACATGACGCAGTGACCTCAGCGATCTGACGGATGACTTCCCGGAAGACTTT
TTTAAGATGAAAGTGCTTCCCGAACTCCTGAAATCGGTCGAGTTTGGTGGCGCCGGCCCCAAAGCTTTCTCCATTGTCAT
GAAGATCGGCACAAAGCTCTCGAATGAGGACTTTGATACAAAGATCACCCCGGTGGTCATCCGACTGTTCGGAAACCCTG
ACCGGGCCATTCGTGTGTGCCTGCTTGATAGCCTTCCGCTCATGATAGACCGGCTTTCGCAGCGGACTGTGAACGACAAA
ATATTTCCGCAAGTTGTATGTATTGCTTCTGTGCTGCTCCACGCGGTCTGCTGACATTGTCCACAGGTGAGCGGCTTCAC
AGATCTGGCGCCTGTCGTGCGTGAACAGACACTGAAGTCGGTTTTGGTGTTGATCACCAAGCTTTCTGAGCGCACGATCA
ATGGTGAGCTTCTGCGGTATCTGGCCAAGACTGCCAACGACGAACAGCCAGGCATTCGCACCAACACCACCATCTGTCTC
GGAAAGATTGCCAAGAATCTCGGCACGTCGTCAAGGTCCAAGGTCCTGATCGCGGCATTTTCAAGGTCAATGCGTGACCC
CTTTGTACATGCTCGCAATGCCTCGCTCATGGCTCTGGCAGCCACAACAGAGTACTTCACCCCGGATGACAGCGCGCTCC
GAATATTGCCGGCTATATGTCCTCTTTTGCTCGACAAAGAGAAGCCGATCCGAGACCAGGCCTTCAAGACTATGGAGGCA
TTCATGCACAAAATCCAAAAGGCAGCCTCTGGCATGCCAGAGACCGCACTGCCACCACCGACGGCCACAGCCGATGGTAT
TGAGCGTGTGAGCACGCCACAGCCCGGCGGCCAGACAAATGGATCTGGATCCGCAGGATCCGCCGGGTCGTGGGCCGGCT
GGGCCATATCGTCCTTTACCAATAAGATATCAACAGCGGCAGGCGAGATTGGGGCAGAGGGGTTGTCTGCAAACGGCGCC
CCGGCAGCCAAGCCGACTCCTCCAGTCCAAGCTGCACCAATTGTATCAGCTGTAGCAGCTGCTAAACCTGCGGCCGCCCG
AACATTGTCTGCCTCGGCTCTGCATCGCCAGGCGGTCAAGTCTCCGCCGACATCGGCACCTATGTCCCGAGATTCGTCGA
CATCCAATGTGGCAGCCGAATCATACTTTGCACAAGACGACAGCAAAGATGCCGATGCGTGGGGCTCCATGGACGACGGA
TTTGGCGACGAGAACGGAGCCGATGCGTGGGACTCCCCGGCGGCAGACGAAGACCCGTTTGAGCCCAAGGCACAGAAGAC
TACGACCACAGCAGCGAACCAAGCGGTCAGCAGCGGCAGTGGCGGTGTGCAGCCGTTCGGCGCAGATGATTCGGAGCCCG
ACTTTGCCGGCTGGCTTGCGGCGCAGGCGAACAAGAAGGGTACCAGCAAGCCGCTGCCAAAAGGCCTCTCGAAAACATCT
GGCAACGCCAACACCAAGCGACCAACCTCGACTAGGCTGTCATCCACACCAAAGACAGCCTCAGCTCCCAAAAAGATTGA
CCTCAAGCCAAAAGATACAGATGATGCCGACGACTGGGGCGATGGCTGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62