GenePrediction:GLEAN_2589 Details

Name: GLEAN_2589
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2040141..2046152 (+ strand)
Length: 6012
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2040141..2044106 (+ strand)
Length: 3966
Type: CDS
Source: GLEAN
Position: GCSC_140:2044180..2044434 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_140:2044500..2046048 (+ strand)
Length: 1549
Type: CDS
Source: GLEAN
Position: GCSC_140:2046109..2046152 (+ strand)
Length: 44
>GLEAN_2589 class=GenePrediction position=GCSC_140:2040141..2046152 (+ strand)
ATGGGTGGCGACCCGAAAAAAAAGAAGGCCGCCATTCCCCTACCAGCACCCACAGAAACAACTGAATCGACAGTGACCAC
TGCGACCGACGTCACAGCGACCGATTTATCCCGTGCCACAGATGACAAATCATCCTACTCTCTGCCTGAAGACGGCACGC
CTGTAACGATAAAAACTCGCGGCCACAGTAGCAACCGCTCCCAAACGTCGCTTCTCATCGAATACTACGAGGGCAGTAAG
GTATCCAGCACCGACGGCATTGGGAATCGCAAACCCAGTGTCCGTGTGCGTGTCAAACAATCTGGCAGTGCCAAGAACGA
GCACATTATGATATCCAAGCCGAAGTCATCCAGTAACCGCAAGGTTTCACAATCTCGTCGATCCACAAGCGGACAGAAGA
CAACATCATCCTCAGCCACCCGTGATATAGACATTGGTGGCAGTGCTATCAGCAGTGTCGATATCGACGATGACAAGAGC
ATGGACTCATACGCCTCGGCCACTGAAGAATCCAACGTCTCGCGGAACCCTATCGTGGTGGAAATTGACCGTGGCGGCAG
CAGTGGGAACTATCAGCGTCAGAGGTCCCGTCGCCCAACCAGCCCGCTAATTCCCGCTGCTGCCAGCAGTCGGGGCTCTG
CTTCCTACATCCATGGCACACAGTCCGAGATCTCTGGCATCTCCGCCATTCCTGCCGACAGCTTTCTGGACGGATCAAAG
TCGCCCAAGCGAACTGACAGTCCTTCTCGGGCCTTTGCTGCAGCCGCCGCAGCAACTGCGGCTGCGGCTGCCGGAGCTGC
TGCTGTAGAACGAAATCGAGCTGCCAGCACCAGCAGGAGTGATGTGCGAGAGCGTGTTACGTTGCCGAAGTCCTCGTCGA
GAGACCGGGGCCGTGAGGGCGGCAGTGGCAAGAAGCACCGGTCAAGTAGACACACCAGCAGTGTCAACCTTGTCGAGAAC
GAGGACTCACCTTCGCATAGACGGTCGAGTCGCCATCGACACCACAACGAATCGGCAGTATCTGGTGCTGACTCTAGCGT
GCTGTCATCAAATCTTTCACCAAACCACAACCCTTACGACCAGTATTCCGTCCGCTCTGGCGGATCCAAAACTTCGATCA
ACAACCCCAAGCTGCTCGAGACAGTCGAGGATGCTATTCGACGACTCATTTTACCGGAGCTGACCGCGCTGAAACGAGAA
CACAGTCGCAAAGATCGTCGCGGCTCCACAACGTCCACTGGTACGTCTGCCTCGAAGGAAGAATTTGACCGGCGCCGGTC
AGGTGCTAGCGACAGAGCCGGGGCGGCGTCCCACACCCCTCGTGAAATAGACGCAGTTATACGGAAGGAGAACCGAGATC
GAGAAGGGCGGCATGCTATGGACGATAGCCCCTCCCCTTCCGCAGGCTACGATTACGACTCAAGGGAAGAGACCGCTCAT
GGCACACGTTCTGTCAGCGAAACACCAAAGAAAAGCTCGGACAAACTAAAGACCGCTACAGCTGCCAGTGCAGCCGGCGC
CGCTCTCGCTGCTGCCGTATTAGCGGATCACGGTGACTCGCCCTCGACCGCCAGGGAACAGCGGCGGCGACGCAGGGCCG
AAGCTCGGAACCGGGGCGCTGAGAACGATGTGACACCATCGACACCGCAGCAAGGCAACTTTGATTCATACCTCAATGGA
CCTCAAAGTGCATCTAGTCGCTCCTTCGACGATGGCATGCAGCACGATGGCGAGAATGCACAAACCCCCGCATCCCAGTT
CGGTCCCAGCGAAGCTCAGTTGCGAAATACTGAACCCAAGGAGTACTTGCGGCCACCGATGCCGTTGATGAGCGAGATTA
ATTCAGATGTCACGAGAGCATCTATTTTGTCCGCCGAAAGCGACCGACCTAGGTCTGCATCTGACGAGCTGCAGACCGCC
CCAGTTCGAGAGGTGTCTAGGGGTATCCCCGCAATGGGGTCTGTCGGCAGTCCGGAACAGACGCCTACCAAGGTTCCTGC
GCTACAAAATCTAGGTACCCAGCATTCCAACATATCTCACGGAGATTTGAAGGCTCTGCCTCGAAATGGCCTGCCTACTG
CGGAATATGCAGGCGGTGACGAAAATTACGAGAACTACGGAGACGAACACGAAACCGGCCAGAACCAGCAGAGTGAGCTT
CATCATGAACAGGAGCACTATCAGGGCCAGTATGCCCAGCATGGAGACGGCGAAGATTACGAGGAATATGACGAGATGGC
ACACTACGGAGGACAGACGTACGATGAATTCGGCAATCAGATCGTACCTGCCCCGCTCAACTACGTCCCTTACCAACCTG
AGCACCGTGGCCTCAGTCCCATTCCAAGCGTGTCAGGCTATACCGAAGGCGGCACAAGCGAAGCGCATCGGGACTCGATT
CATGCTGGCACGGCTGTCTCTTCGCCAGGCAAGTCACCCATGCCAGAGCGGAAGCCCCTCGCCTCGCCGAACTCCGCACG
TGGCAATACCATGGGCCGCGACTTTGATCAAGACGGCAGCGCCCTTGACGGCAGCGCACTTAGCTCCAACGCTGGCTACT
CGGAACTTGCGCCCACACAACTCACCGACGAAGGCAGCAACGTCTACAGAGCTGTCCAAGGAATTGGTGCGAACCCGAGA
TTTGTTCGCCCTCCGATCGGTGTTGAGTCGGCCGTTGCCTCCTTAGTAGACGGCTCTATGCTGGAAGGGTCAGCATTGAC
CGGGGGTTCTAGCGTCAACGGCGGGTATGGTCTGCTCCCAGGCGCCCGTGGATCTATGGACACGCTTGAAGAAGAGACAT
CGTATGATCGCGCCAACTCTCAAAGTCGCTCTGTCAAGGGCTACGGGCATGAGCTGAATAACGAAGAGGAGCCACATCGG
GCCCACGAGCAGGAGGACAGTCGTGAGGTCATGGCTGCATCTCCGACTACGACAAGAACAAACCCGTCTGAATTTGCTGG
CGAATATGAACTCGACCAGTATGGACGCAAGGTTCGCCGGCTGTCGCCCACTGTATCAGAAGCCGCTGCCATAACGGCTG
GCGCCATCGGTCTTGTTATCCGCGCTGCGAAAGACCGTGGCCAGCAGCCACATGAGTCTACTAGGCTGGAAGAGCATGAA
GGCTATCACACACACCCCGATGATTGGGCGCCGGATGGGGTTCAACGAAATCGTTCCTTCAAGGAACGGGCTCAGAGCGG
ACGCTACCCAGGCAATAAGCAAGCATACGTCTCTGAGCATACAGAGGAACATGATCAGCCCCGGATGAGTGCAAATGGCC
TGCCTGATCTACACGATCCCATGCCAGAGATTGGCTTCGGTTACGAAGAAGACGATCTCGAAACGAACCCGTCTCTTTTA
TACGGTCCGACGTCCCACCATGACGAAGCCAGCTGGCGCGTTGGCGACCGGACGCCCACACAGGAGCACCATGACACAAG
TACACGCAGCCTTGGTCTCGCTGAAACGCCTGCTGCGCGGGTCTCTTCTCAGCACAGCCGACAGACCAGCCAGGAACACG
ATGAATGGCAGCGGTCGTCTGACGACCGGAAGAGGGATACTCTGCTCACAAACCCGTACGAAGGGACAAGCCCGATTGTG
AACGAGGACCTGATCAAGTCAACTCTCCCAGCTGTCGCCACAGGTGCAGGCGCGGCTGCTGGCTACAACGCCAGTGTGGA
CTATGCTACGGGGAGCCCTCTGGGGGCCAGATATGATGAGGGCTATGAAACTCAGGGTCCAGGCAAATCTCCAGACCTGA
CTGGGACCAACAAGGGCAAGGAAGTTGCCTTTCCGGATCATATGCCTGCGTCGTTTGGTGGTCAAGATGACCCGTTTTAC
TCGCTCAACCAGACGAGACACTTCAGCGGCCTCTCTCAAGGAATGGGAAGTCCTCTATATGATCCCGCCACTGGTGCTGG
CATTGATCGCATTGAGAACAAGGATATTATCTCCCTCATGCAGCATGTATGTTCTCTGTTTCTGCACCAACCAACATTCT
ATCTCGTGTCGAGTTGAAGACTTTGCTGACCTATTTTAGCTGATGGTCCGGGACGCTCAACGAAGTGCCCGTGACACGGA
AATCCTGGTGACACTTGTGCGTGCGGCAGCAGAGATGCGCACTTCGTTTGAGAGCGTAAAATCCCTGCTCGCTTTGCACG
AAAAGGGCATCAGCAACGACTTTTCCAAGAAGCTGGCCGACAGCGAAGATGCCATCATCACGGAGGTCCTTGACCTGGGA
CCGAAAAAACAGTCCGCACCCACCTGGGCGGGCCCCGTCCGCTGCCTGGCAGCGGTGCGCGGTCTCTGCACGCCGCCCCT
TCTCAGGCTGACATGGACGACCTGCCGACTAAGCGTCAGAACATCTTCCGCCGCGCTCTTAAGTCGTTGAACGCGAAGGG
CAACAATGATCTCACCCGAATCGAGGACATGCTTAACCAGCTGTTGTTGCAGGTGGATCTGTTGAAGGCGCAAACAACCG
TGGAGTCTGGGGTCATGGGCACAACTGTTTCTGGTGGCCGAGCTCCCTCTCCATACGACGACGTTGAATCGCATATGCCA
TACGAACACGAGCAAGACCGCGGTTACGAGCCGGAGGGTCATGCGGGCACGTCCACTGCCAGCCATGCAAGCCAGTCTGG
GCACTTGTCTGTCCATTCTCGTGGCGGCCCATCGGTCACGTCCAGAAACGGTGGCTACGACCGCAAGTTTTCTGATAACC
GCATCAGCACGGTCCCGGAGGCGAATGAAGATGACCTGGAGTATGGACATCAGAAGAGTATTGCCAGCCCCCGAGCCTCC
ACGCCCACCCATGCTCGGTATGGCAGTCCCGCGTCGTTACCTCAGATGAGTTCAGCGCTTTTAGCAACGCCTCAGCGCCA
AGAAGAATCAGTGCAGCCACTCCAGCCACAGTCGCTTCCGCAGCTTCAAACGCACAACCAGGATCTGCAACAGACACCGC
AAAGCGGCGACAACACACCCAGAACAGAAAAGGGAAAGAAGCACAAATCCACCGGCTCGTCAAGCTGGCTACCCAAGATC
TCACGGTGGTCGGAGACAACAACATCAAGTGTCGGCCGCGTGTTCCGAGCCAGTCGTGACTCTAAGAAGGGCAATGAGGA
ACTGGGCTATCAAAGCGGACCATCTCGCTCTAGGTCAGACCTGGCCAGCTACGATGGTTACCACATGCCCACTGATCCCG
AAGGCGAGGACAAGCTTCACGGTGGCTTTTCGGAGCAAGACCTGCACCATGACGAGTACTACCAGCCTCAGACGCTCCAA
AGCGAGACTCAAGACTATGGCCTCAACGCCAACAGCACGGATGTCGTGCCGCCCGACCCGAAGTCATACATGACGCCAGA
GGACCCGAAATACCATGTGCACCGCAACTCGCTGAACCTGCAGCACCCGCAGCCCAGGTCCGGACAGCCTTTGAAGGCAA
CACTTGAGAGTCGGGCAGAAAACTTTGACTCCCCGATGAGCCCCCGGTCAGCTGATTGGGCTGGATCGGCCACGTCGCTT
CACCGATTCCCTGGCCAAAACACCAACCGGTATAGCGATAGCACTGCTACGAACGCGGCAGCAACTCCGGCCAACGTGGC
CGCAAATGTGTCGCAGCAAACATACTGGGAATCGCAACGGTCCGGGAGCCGTCAGTCTCAGGGAGCTCCGCCCCGTCCAC
CCAAAGAGCCGCTTGACGAATCGCAGCAAGCGACTTATGTGACGGCGGCACAAGTGACATCTAGCTACACGGGCAGCCCG
CGGCTTGAAAACCGCAACCTCAACAGCGCACTGGGAGTGCCGACGCGACGCCCAAGCGGCCCTCGTGCGATGACGCCGAA
GAGTGAGCGGAGCATGCGAAGCTATAACGACGAGGAGGCTGCAAATGATTCGCGCAGACGGAAGAGAGGTGTGTGACTGT
CAAGATCAACTGTCCATCCTCTGCTACGCGTCAACTGACTCTTTTCAGACACTTTTGGAACGGTGGCGTCTCAGGACACC
GAGACCTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62