GenePrediction:GLEAN_258 Details

Name: GLEAN_258
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:585408..586545 (+ strand)
Length: 1138
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:585408..585461 (+ strand)
Length: 54
Type: CDS
Source: GLEAN
Position: GCSC_167:585561..585852 (+ strand)
Length: 292
Type: CDS
Source: GLEAN
Position: GCSC_167:585944..586545 (+ strand)
Length: 602
>GLEAN_258 class=GenePrediction position=GCSC_167:585408..586545 (+ strand)
ATGTCCATGGGACTTGTTGGCCAAGACGAGGACGACGATGACGTCCGCAAGATCGTGGGTCCCCTCATCCATGACCCGGC
CCTCCCACCCTCGTTTATTTAGGGCCTCCTCCCAGTGCCGATGATACAAGGCCCTGACGAACACCTCATCCAGGTCCACG
CCGTGGCTTTGACCATCGGCGAACTGGGCTGGCTCGGACCAGCTGCAGCAGTGCCCCCAATCCCCGGCTACGAGATGTCC
GGCACCGTAGTCGAAGCGCCCAAGACGTCACCCTTCCAGCCAGGCACCGAAGTCTACGCCTGCACCAGCTTTGCTCGCCA
GGGAAACGCGCGCGAGTTCACCATCGCCTTGACAGAGGAACTGGGCCAAAGGCCGGAGAACCTCTCCTGGGAGGAGGGCG
GCCACGGTGCCCTTATCGGCTCTAACGGCCTGGCAGGCTCTCTTCGTTCACGGCGGCCTCAGCCTGCCCTCGCTACGACC
GATCGCCGTCGCCGCGGAAAGGCCACAGCCGAGACAACAGACACCACTCTCTGCAGCTACTACTGCTCCTCCCTCCATAC
CGCCGCAAGCTTCATCGACATGGCACCAACCGCAGCGTTCGCTGAGCATTACAGGCTGTGGCGCCAATGCTACCAAGCGC
GTGCTCATCACCGCTGCGGCCGGTGGTGTCGGCCTCTGGGCCGTCCAGCTGGCCCGGCTGGCTGGTGTCGGTCACATCAC
GGCCACTTGCGGGGAGGGAAACGTGGGCTTTGTCCGCAGCCTGGGGGCCCACCGCGTGGTGGACTATGCGGCAAACAGAA
ACAACAGCAGAGACAAGTACGACCTTGTGCTTGACTGCGTCGGCGGCGATGTCCTGCGCTATGCCTGGACTCGTGCACGC
CACGGCGGCATCGTCATCAGCGTGGCGGCTCCAGCCGACCAGTTCAGGCCCGAATCGGGCGTCGGGATGGATGTTCGCAG
TGCTTGGTTCAATGTCGAGGCCAACAGCCGACAGTTGCAGGCCATCACGGATCTGATCGAAGCAGAGATGGCTAGGGCCG
CCTTCGACTCTGCTTTCCCGTTGGCTCAGCACGAGGAGGCCTTTGGAAATGCCTATAGTGGACATCTACGCGGCAAAGTG
GTCTTGCGATTGGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62