GenePrediction:GLEAN_2591 Details

Name: GLEAN_2591
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2058790..2061981 (+ strand)
Length: 3192
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2058790..2058808 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_140:2059084..2059322 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_140:2059382..2061195 (+ strand)
Length: 1814
Type: CDS
Source: GLEAN
Position: GCSC_140:2061273..2061981 (+ strand)
Length: 709
>GLEAN_2591 class=GenePrediction position=GCSC_140:2058790..2061981 (+ strand)
ATGGCGTACAATCGATTAGGTATGTCCCTCCAAATCACCCTGGCCCTCACCATACCCTTACTTTCCTGCTTTCCCTCTGC
CTCACCTGTCCGGGCCGATCTCTTCTGCTTCGGTCGGCTCTTGATCTTGTGCTGGAAACAAGTACGCCCTGGTGTGCGCC
AAAGAGATTAAAACCCGTCGCAACAAGTAGAGGCACTGGCTGTCTCTTCGTTTTTGCTCTATCCTTCTCTTTTCGTTCCT
CTTCCGCCGTGCCTTTGACCTTTTCACCACAAACTTCAACCGTCCTTCCTCCAGGCTTGCGCGATTGGCACTCTCTGCTC
ACATCCTCATTAGCAGACGACGGTGGTTATTACGACCAGATGGACCCCCGGGCCCATCGGACGCCCTCACCAGGCAACAC
TATCCAGCAAGGGTATCAGCTCGATGACAATCCTCAGGGGAATTATCCCGCGGGCCATGGCCTCGATGTTCACAACCCAG
CATTGAACCAGGGCCGCTTCAGCCCAGGCGACTCGCTACAAATGCAAATGGCTGTAAGTCTGGATCTGTAGTAGCTCCTT
TCACGTCTTCTGTCGCTAACTTTCTTCTGCAGCACTCGGTCGACAACCTCGGTGGGGCTTATGACCCCAGGCCGCATGGC
GGCGAGTATGGTGTCAACCCGGAAGAACATCACGATGCATACTACAACACGCCCTACGAGCCTGCCCAGCACGATGGCCA
GGGTGCTTATGACCAGTTCGATACCGATGGCAGACCGCTTCTTCAACAGGCTGGCTCATACGAGACGCCCGGCTACGGAG
AGCCTGGCTACGGCGAACCCGGTTACGAAGACCCTGTCCTTGATCGGCCCCCGCAAACGACGCCAGCACCTCAAGGCGGT
GGCCTCAAGCGTTGGAAAACGGTGAAGCAGGTGCTCCTCTACCGGGGCAACTTGGTACTCGACTGCCCGGTTCCTCCCCG
GCTCTTGAGCCAGCTGCCGCACGGCGAGCGCGACGAGTTTACGCACATGCGCTACTCTGCCGCCACATGTGATCCATCCA
ACTTCTACGAGGACAATTTCACACTCCGGCAGAAGCTTTTCAGCAAGCCACGGCACACCGAGCTGTTTATTGTGGTCACC
ATGTATAACGAGGACGAGATTTTGTTCGCCCGCACCATGATCGGTGTCTTGAAAAACGTCGAGTACATGTGCAAGCGCAC
CGAGAGCAAGACCTGGGGAAAGGATGCTTGGAAGAAAATTGTCGTTTGTGTCGTCAGTGATGGCCGTGGAAAAATTAACC
CGAGAACCAGGGCTCTACTTGCCGGGATGGGTGTATACCAGGAGGGCATTGCCAAGCAGCAGGTTAACGGCAAAGATGTG
ACGGCGCATATCTACGAATACACTACCCAGATCGGCCTGCAGATCAAAAACAACATTGTACAGCTGGTGCCAAAACAGCA
GCCTGTCCAGATGCTCTTCTGCCTCAAGGAGACGAATAAGAAAAAGATCAACTCTCACCGCTGGTTCTTCCAGGCGTTTG
GCCGCGTCCTCGACCCTAACATTTGCGTTCTGATCGACGCCGGTACGCGCCCTGGAGGTAACTCCATCTACCACCTCTGG
AAGGCTTTCGACCTCGAACCCATGTGCGCTGGCGCCTGCGGTGAGATCAAGGCCATGTTGGGTACTGGCGGCAGGAACCT
GATAAATCCGTTGGTTGCGGCTCAAAACTTTGAGTACAAGATGAGCAACGTTCTCGACAAGCCGCTCGAGTCTGCCTTTG
GCTTTATTTCTGTGCTGCCGGGTGCCTTCTCGGCCTATCGCTATGCCGCCCTGCAAAACGACAAGAACGGACAGGGCCCT
CTCGAAAAGTATTTTGCCGGCGAGACGCTTCACGGCGCCAGTGCGGGCATCTTCACTTCGAACATGTACCTGGCCGAGGA
TCGTATCCTGTGTTTCGAGCTCGTCACTAAGCGCAACTGCCACTGGCTCCTGCAATACGTCAAGTCTGCGACAGGAGAGA
CGGACGTACCGGACGGCCTTTCGGAGCTAATTCTGCAGCGTCGCCGGTGGCTAAACGGCTCCTTCTTTGCTGCTCTCTAT
GCGATCGTCCACTTCCACCAGTTCTTTCGCTCCGATCACTCTCTTTTCCGAAAGGTTATGTTCTTTATCGAGTTTGTCTT
CAACACCATTAATATGATATTCGCCTGGTTTGCCATTGGCAACTTCTTCCTCGTTTTCAAGATCCTCACATCCAGCCTTT
CTGATAAGGACCTACTCGGCACAGTAGGCAATATTTTAGGCGTGGTGTTTGAATGGTTCTATGGTGGATGCCTCATCATT
TGCTTCACGCTGTCCATGGGCAATCGCCCGGCTGGTTCGGGCCCATACTATATGGCTATGGCTGTCTTCTGGGCTATCAT
TTATGTGTAAGTGCTGTCTTTTGCCATCCATGACATCGTCTCCTGCCACACACAACGCGACGTTCTAATTGTTTGGCCTC
TAGGTACCTCATGTTTGCTGCCGTATTTATTTCAGTCAAGGCTGTCCAGACTGATATTCATGATGGCCTAACCGGCTCGG
AGCTCTTCTCGAACAAGGTTTTCGTCACTCTGATTCTTTCAGTCATGTCGACATACGGAGTGTGGCTGATTGCGTCTGTC
ATGATGTTCGACCCGTGGCACATGTTCACCTCACTAATTCAGTACTTATTGCTCACGCCTACATTCACGAATATCTTGAA
CGTCTACGCTTTCTGTAACACACACGATATTTCGTGGGGTACCAAGGGCGACGACAAAGCCGAGGCGCTGCCTTCAGTCA
GCACCAAAGATGGCCAGGGCAAGACGGACCTGCCAGATGAAGGTGACTTGAATGCACAGTATGAGCGGGAACTACTTGCC
TTTGGCGAAAAAGAGGTCAAGGTGAAAACAGAACCGACGCCAGCCCAATTGGACGAGAAACAGCAAGACTACTATCGTGG
TGTGCGTACCGTCGTGGTGGTTATTTGGATCATCAGCAATTTTGCCCTCGCCGCTCTTGTCCTGAGTACCGCAGGTCTCG
AAAAGATCATTTCGTCGAATTCTGCCTCCGCCGATACCAGTCGTGCGACGATCTACATGGCCGTCATTCTCTACAGTGTA
GCAGCCCTGTCTGCTTTCAAATTTCTGGGCGCTCTATGGTTTTTGATAGTGCGGATGTTCCGTGGTGTATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62