GenePrediction:GLEAN_2592 Details

Name: GLEAN_2592
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2062979..2065265 (+ strand)
Length: 2287
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2062979..2063009 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_140:2063070..2063155 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_140:2063444..2063564 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_140:2063620..2063733 (+ strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_140:2063809..2064054 (+ strand)
Length: 246
Type: CDS
Source: GLEAN
Position: GCSC_140:2064122..2064871 (+ strand)
Length: 750
Type: CDS
Source: GLEAN
Position: GCSC_140:2064934..2065265 (+ strand)
Length: 332
>GLEAN_2592 class=GenePrediction position=GCSC_140:2062979..2065265 (+ strand)
ATGGGGATTTGCAGCTCCCAGTGCTGCGGAGGTAAACAGCCTTTTTATTTTTCACGGCCTCGCGATTTGCTGCCTTGCTG
ACATCTGAAAGGCAAATCCCGCGATGGCCTCTACGAGCCCGTCCTTGCCGATAGCGAACGTGAGGCAGTTGCAGACCTCC
TTCAGTATCTCGAAAATGTTTGTCATTCCCATCTCTCGTTACTACCTTCACCGATCCGAGCTTTCAGGCCACCCAATTTC
CCCTCCCGTATCTCGACGACACCACACACCACTATCACCTAGGCGAATGCATGTGCCGACGGCCTATGTACCCCATTCTC
CCAAAAGTCGTTCAAGTGTGCGGCTTTCTGCACACAAGCATTGACTTAAAATACCCTGGCAGTATTGGGCTATTTTGTCT
TTAGCACTACGTCACGCTTCGGTCACGATACCTATGAGAACCCACATTGGACTAACTTTGCACAGCGCAACGAAACAGAC
TTTTACTCGGGAGAGCCGCTGCGTGCGCTCAGCACACTTGTCTTCTCGGACAACATAGACTTGCAACGAAGTGCAAGCTT
GACGTTCGCTGAAATTACAGAGAGAGGTACGGTATCAGCTGGGACCAAACGAGATCAAGAAAACCATGCTGACACCCCCA
GACGTGCGAGAAGTTGAGCGGGACACTCTCGAGCCAATTCTCTTCCTTCTGCAGAGCCCCGATCTTGAAGTGCAAAGAGC
GGCGAGCGCTGCTCTTGGAAACCTTGCCGTGAACAGTATGTGGACCGTCGATCGTCCCTTTGCTGCCCAATCTGTCCCAC
TTCGGCATCACTGACGTACTTGTCTTTCAGCTGCCAACAAGGTTCTGATTGTTGAGCTGGGCGGTCTTGGACCCTTGAAG
CGCCAGATGCAATCGCCCAACGTTGAAGTCCAGTGCAACGCCGTCGGCTGCATCACCAACCTCGCCACACATGAGGACAA
CAAGGCAAAGATTGCTCGCTCGGGCGCCCTCGGACCCCTGACGCGTCTCGCTAAGTCGCGAGACATGCGAGTGCAGCGAA
ACGCCACGGGTGCTCTTCTCAACATGACTCATTCGGGTATGATATCCTTACTGCCGTCTGCCTCACCTTGCTGGGCCGCA
ACTTCCTAACGTTACCCTTCCAGATGAAAACCGAAAACAGCTAGTCAATGCTGGTGCTCTGCCAGTCTTGGTCCAGCTGC
TCTCCTCTCCCGACGTCGATGTACAGTACTACTGCACGACAGCACTCAGCAACATTGCTGTAGATGCCACGAACCGAAGG
AAGCTGGCACAGACCGAGCCGAAATTGGTCCAATCCCTCGTCAATCTGATGGACTCCTTATCGCCCAAGGTTCAATGCCA
AGCCGCTCTTGCCCTGCGCAATCTTGCATCCGATGAGAAATACCAACTAGACATTGTCCGTGCCTCTGGCCTGCCGCCTC
TTCTTCGTCTTCTCCAGTCCTCCTATCTGCCGCTTATTCTCTCTGCTGTCGCGTGCATACGGAACATCTCGATCCACCCC
ATGAATGAATCGCCTATAATTGAAGCAGGTTTCTTGCGGCCTCTGGTGGAGTTACTCGGTTCTACTGACAACGAGGAGAT
CCAATGCCACGCTATCTCGACTTTGCGCAACCTAGCGGCCAGCTCAGATCGGAACAAGGCTCTTGTGCTGGAGGCTGGTG
CCGTACAGAAATGCAAGCAGCTGGTGCTGGATGTGCCCGTGAATGTTCAATCAGAAATGACTGCTGCCATTGCTGTTCTG
GCTCTTAGCGACGAGCTCAAGATGCACCTACTTGGCCTGGGTGTATTTGATGTCCTGATACCGTTGACACAATCTTCCAG
CATCGAGGTGCAAGGCAATAGCGCGGCTGCTATGGGCAATCTCTCCTCCAAGGGTGAGCCATTTTTGTTAATATTACAGT
GTGTCGATACTACATGCAGTGGCTAATCTGTCTAGTTGGCGACTACTCGATGTTCATCCAATACTGGCTGAAGCCAAGCG
ATGGCATCCATGGATATCTGAGCAGATTTCTGGCGAGTGGTGATGCTACATTCCAGCACATAGCGATCTGGACCTTGTTG
CAACTTCTCGAGTCAGAGGACAGGAAGCTCATGAACCTAATTGCCAAGTCGGACGATATTGTGGAGGTTGTTAAACAAAT
TGCGAAGCGTCCTATCGGGTCCGACAACGAGCTGGAAGATGACGACGAAGGAGAAGTTGTGAATCTGGCTCAGCGGTGCC
TCGAGCTTCTCGGACAGAACAACCCGAAGTCCCATATCGAAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62