GenePrediction:GLEAN_2594 Details

Name: GLEAN_2594
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2068479..2070092 (+ strand)
Length: 1614
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2068479..2069162 (+ strand)
Length: 684
Type: CDS
Source: GLEAN
Position: GCSC_140:2069223..2070092 (+ strand)
Length: 870
>GLEAN_2594 class=GenePrediction position=GCSC_140:2068479..2070092 (+ strand)
ATGGCGACACCACAGCCGAGCGAAGGTGTGACTGCCAACAGCGAGACGCCAAAGAAGGATGTCACGGCAGAGGGAAATGC
GGGCCAGAAGACTGGTGGGAAGGCACAGGCACAGAAGAGCACGGCGCCCCAGCCGACAGGAGACGCGCCAAAGAAGCCTT
CGGGTGCAGAGCTGAAGGCGCAGAAACAAGCAGAGAAGGCCAAGCGGAGAGCAGCCGTGGTGGCGGCGAAGGAGGCAGGA
GTGGGCGCCGTTCAGCTAAAAGCAGTACCAGGAGCGGGTGCAGCAGCAGGTGGCGGTGGCGGCGGTGGCGGCAAGGCCAA
GGGAAAGCAAGGCGCAGACGCCGCAGGCAATACAGGAGGAGGTCCTGGTGTCGGAGCAGGCTCCGGAGCAGGGCCGCTGA
CAGGTCCGATGGCACGGCGGCCATCCGTAGCTGCGGTTGCGGCAGCGGCAGCGGTCGCTGCGGCTGCCACGGCGACGTTG
GAACGCGAGAGAGAGCGCGAAAAGGATTACCGCAGCGGCATCCCCGAGTGCTTCAGCCATCTGTCGATGGCGAAGCGCAT
CTCAGTCTCCCAGGCACACAAGGACGTCCATCCGGCCGTGCTCGCGGTTGGTCAGCAGATGGCTACCTTTACGCTGCGTG
ACAGCATCGCCCGTCTGGAGGCTACACTCGTCGCATTCAAGAGGGTGTGTTGACGCCCCTGCTGAACCAATTCTGCGCTG
TATATGCTAAGCTGTGCCCGATAGGTCATCCAGTCCTACAGGACACCGCCGGGCAACGCCTTCTCGCGGCACTTTGTGTC
GCATGTGCTCAACCCGCAGATCGAGTACCTGACAGAATGCCGGCCAATGTGCTTTGCCATGGGCAACGGGATCCGGTTGC
TCAAGGCGCGCGTGTCACAGCTGGACCTGGACTTGGACGACAAGGATGCGATCGAAGACCTGTGCGACTCCGTGGACGCT
TTCATCCAGGAGCGCATACACGTCGCGGCCGTGGTCATAACGCGCGAGGCGGCCGAGATGATTGATAATGGCGATACCGT
CTTGACGTACGGAGGACCCCGGTTGGTGCGGGCTGCCCTCGAAGAGGCTTGGGCCAACGGCATCCGGTTCGACCTGATCG
TCGTGGACGACCCGGACGACACGGCTGCCGGCCAGGCACTGGCCAAACACTTTCGCTCGCGAAGGGATACCGAGACGGCA
GCAAGTCGTCGTCCTGAGATCCACGTGACCTACAGTCACTCTCTCGACGGCCTTGACAGTCACGTGGCGCGTGCCACAAA
GGTGCTGCTGGGCGTCGAGTCGGTGTTTGCCAACGGCGCACTGCTGGGGCCTGTTGGCACCTGCGACGTGGCCCAGTCGG
CCTCAGCTCTGGGCTGCCCGGTCATCGCGCTGTCAGAGACGGTCAACTTTGACCGCGACCGTGTCGCTACGGATGCGCTG
GCACACAACGAGATCGACCCGGATCACTGCGACAGCGACTCATTTCGGCTGCTGTTCGACACGACTCAGTCCAGCCTGGT
CAGCATGCTGATCACCGAGTACGAGGAGGCCAGCGGCATGGTGCCTGCGCAGGCCATCTATTCCGTCTTGCGAAGCAAGG
AGGACCTCAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62