GenePrediction:GLEAN_2595 Details

Name: GLEAN_2595
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2071327..2074435 (+ strand)
Length: 3109
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2071327..2071581 (+ strand)
Length: 255
Type: CDS
Source: GLEAN
Position: GCSC_140:2071644..2072190 (+ strand)
Length: 547
Type: CDS
Source: GLEAN
Position: GCSC_140:2072377..2074190 (+ strand)
Length: 1814
Type: CDS
Source: GLEAN
Position: GCSC_140:2074355..2074435 (+ strand)
Length: 81
>GLEAN_2595 class=GenePrediction position=GCSC_140:2071327..2074435 (+ strand)
ATGCCGCTCGCAGCAACGATTGGGACTGCAGACGCTGCAGCCATGTCTGCGTCTGCGCCAGCGCCTGGCTCGGCTGCCGT
TTCTGGGACCGAGACACCTCATCCGGTGACGGTAGCGACGAGGTCTTTCAAAGCCTCTGAGCTACCATTATCGTCCGCTG
TCCGGACAGCCATCGAAGGGCTTGTGCACACGTTTAAGAAGAAGGGTGGCTACGATGCCATTCGGAAGCAGACGTGGGAG
AAGTTTGAGGCTAGCGTACGTGCTTCCGCGGATGCGTGCACGCTCCATGCTCAGAGAGTGACTGACACAGATCACAGGGC
TACGAAGAAAACGTGACGAAGCGCATTCTCGAGATTGCCGAGCAGGAGGTGGAGAGCAATCCGGCCCAGCTTCTGTCCTT
GGACCGGGGCAAGGCTGCGGCGCTCATCGACGGTGCCCTGGACCGAGGCAGAGTCTACCAAAACGCCCAGGAGGTCATCG
AGGCGCTCATTGACTCGGACGCCATCGAGTCGCATCTCCGCGAGATCCGACGGGCCGAAATTGGCGACGAAGCGGCCTCG
GACGAGCTGGCGCGCGGCGCGCGTACGGACGAAGAATATGCCACGGAAACTGCCCAGCGCCGTGCTGAGCGTGAGCGGGT
GCGACAGGAGCTGCGCGCAGTGGAAGAGAGCAAGCGTCGGCTGGAGCGAGAGATCCGCGAGAAAGAGGAGGCGCGACGGC
GTGAAGAGGAGCGGGAAGCCCGTGAGGCCCGGCGTAAGGAGGAACGTGAAAAGGAAGAGCGGCGTGAGAAGGAGCGAGAA
GAGCGACGTCGAGAGCGAGAGCGAGAGCGCGACCGGGAACGGGAACGGGAACGGGAACGCGACCGTGAGAGAGACCGCGA
GCGGCGAGAACGGGACAGGGAGCGAGACCGGGATCGAGACAGAGATCGAGATCGAGACCGAGACCGAGATCGCGACAGGA
GCAGAGACCGAAGGGGCCGGGACCGAGATCGAGATCGAGATCGAGATCGACGTGATAGAGACACGTCAAAGGACAGCCGG
CGTCGGGAAGGCGATCACGAGGTGGCGGGCGGGAAGCCGGAAGAGCTAAAGAAGCAGCTTTCGGGCGAGGAGCTGCAGCG
GCTGGAGGAGTTGGCGATGCAGGACCTCCTGCGCGAGAGCAAGGCGTCGCGAGCGGCGAAGCAGCCAGAGATGGAGATCG
ACGAGACGCTAGCTCCTCCACCACGCAAGGCGATGCCGGCGTCGGCGATCCAGCCGATACGGCGAATCCCACCCAAGGCT
CCTGCGGACAATACAAAGGTGCAGCCAGCAGAGAGCGTGGTCAGCGGCAGCAGGCCGGAGCCAAAAGCCCAGGCCCAAAT
GCAGGCACCTCCGACGGAAGCGAATATTCTGATGCATGAGGGCAAAGGCGGTGTCAAAACTGCTGCAGCCGTGAAATCGT
CGCCCAGAACAGAGCCAGCGGTAGTAGCGAAGGACAAGTCCGAGACGAAGCCGGCCAAAGCGACGGACGAGACGGCTAGC
GGCAGTGCAAAGACGGCAAAGACGGCCACGCCCGCTCGAGAGCCGTCTCGGCATCGTGATAGAGACACGAGCCGGCACAG
CAGGGCATCGGAGCGTCGACGCGGACGGCGTTCAGCATCGCCAGACCGCCGTGGGCGCAGAGATGGGCGGAGTCGATCGA
TCGGACGGAGACGGGACTATCGCGAACGGAGTCGAAGCGGATCGAGAGCTGGTGACCGGCGGAATGAGAGACGCAGCCGT
AGCAGGGAGCACAGGGCAAGGGACAAGGAGGCAACAGGAACAGCAGCAGCAGGGATGTCTGGGATGTCAGGGAAGGTTGA
TCGCAAAGAGTCGACACGGCGCAGCCGGTCCCGACATGATGCTCGAGATGCGCGGAAACAGACTAGGTCTCCGTCCCGTC
GACGAAGAGACTATCGGGAACGCGATCGCAGCACATCGCGGACATCCAAGCCGAAGGACCGCGAAACAGGTACAGGGGGG
CCGAGCCGAGCGCGATCGAGATCACGAACAAGGCCGTCGACACGGCGGGAGGACAGGGTAGAGAAGAACGAGAAGAACGA
GAAGAACGAAAAGGACCAAAAGGACCAGAGAGAGACATACCGACGGCGGTCGCATTCACGATCCCGCCAGCGCGACGAAA
AACGTACGGCGACGGCTTGGGAGAGGAGCCGCTCGCGGGTGCGATCTGATCGACGCAGCCGATCGCCACGAGGAACGGCA
GTGGACCGGGCAGAGCGAAAAGAGGCAGAGGCGCGAAAGAGCCGCAGCCGGTCGCCTCCTGGCGGTCCGGGGTCTCTGTC
AGCGACGTCGACGACGCGGCCGCCACCAAATCTGGACCGGGACGGACTGGAGGCGTGGAAGCAGGGCGAGGTGAGGAAGC
GGGAGCTGGAGGCCAAAGCATATCTGGCAGCACAGAAGGAGGCACGGGAGAAGGGGTTGCCGGTGCCGGGTGTGGACGAC
AGGCGGAGCACAGGCGGCGTCAGCGCGGGAGCGACGGGGACCAGTGGTGTAGCAGGTGACCGGTCGCCAGAGATGAAGCG
CAAGTACGAGCCGGACGAGATTGATCGCTACGTGCCGAAAGAGCGGCGCCACATTGACCGGGCAGTTTCGGGCGGGACGG
TGGACCGAGCGGTAGACCGGGCTGCAGGTCGTGATCTGCGTGACTTCCGCAACCGAGACGAGCTGACGGCTCGGCGAAGC
AGCCGGTCGCGCAGTCGGAGTCCACGGCGAGAGTACCGGGATCGGGACCGGATTCGAGTTCGCGACGACAGGGACCGTGA
CCGAGACCGAGACTGGGACCGGGACCGACGAAGTCGACGAGAGAGAAGTCGCAGTCGAGACCACGTGAGAGAGCGAGATC
GAGATCGGGATCGGGATCGTGACCGTCCTCGAGACCGAGACCGAGATCGAGATCGAAGCAGAGACCGTGATCGCGACCGG
GACAGGAACCGCGACAGGGAGCGGACCCGAGACAGAGACCGGGATCACGATCGAGAACGACACCGCAGCCGCAGCCGCAG
CCGAAGACGACGGAGCAGAAGCCGCTGAAGCTGGAAATGGCCTCGAGCGAAGACAGTCGAGGAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62