GenePrediction:GLEAN_2596 Details

Name: GLEAN_2596
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2082229..2084639 (+ strand)
Length: 2411
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2082229..2082249 (+ strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_140:2082377..2082811 (+ strand)
Length: 435
Type: CDS
Source: GLEAN
Position: GCSC_140:2082882..2083841 (+ strand)
Length: 960
Type: CDS
Source: GLEAN
Position: GCSC_140:2083907..2084205 (+ strand)
Length: 299
Type: CDS
Source: GLEAN
Position: GCSC_140:2084261..2084639 (+ strand)
Length: 379
>GLEAN_2596 class=GenePrediction position=GCSC_140:2082229..2084639 (+ strand)
ATGAGACGGTTAAGCCAGAGAGTCAGTTTGAATGCTCTTGTTGCATTCTGGGCGCGCATTCCCCCGCGGAAGACGATGGG
GTCCCACCGAGAGACGTGTTCTGATGCCCGGCTTACCACTGCTTGCTAACGTCTTATCTGTCTTGTAGCTTTCGCGAAGC
AAGGATCCGAACAAGTCGTCCAAGAAAAACAAAGACTCCAAGGACGGCACCTCTTCGCCTTCGAACTCCTCGACTGCAGC
GAGCCAATCCCCCGTCCTCACGCCGTCCTCCTCTACCTCTACACTCAATGACATCCGCAACAAGCCTCTGCCGCCGAGCA
ACACGAATCCAATCAGCGCGCTCGGTAGCATTGTCGGCATCGGCTCCAGCGACCATGGCAATGGCAGCACGCCGTCAGGG
CAGGCACCGCATGCCGGAGCCCTGAATGGCGCCCAGCCAGCCGCGGCCGCTTCGGACCGCTTCAACACCATGGGTGCCAC
GCAGCCGGGCTCAAACGGGGGCGGCAATGCAGCTGCAGGCAACGACTCTCCTGGTCGCCTGGGACAGCTCCCACCTACCG
TCATTGTTAGCCCGAGTGCGCCAGTAAGCTCTGTTCACTTGCGCGATTATTGCTTGCCTCGATCCATCCGTGCATCACTG
ACAGCTCGTCTAGCATGTGCCTCCGCCGGGATCCGCTGAGACGATGCCACACGATCTGGCCCCACCAAAGGCTGGCCAGA
AGTCAGGGGCCTATGATCGCCTGCTGCAGTCGACACCGAAAGATGTGCCCGAAGGGATTCGGACGCCCAAGCGACAGCAC
TCGTCCCGCTTCGACATCTCGTCCCACCGCGAGCTGGACAAGCTGCCGGGCTTCCATGAAGTCCCGCCCAACCGCCGGCA
GGACCTGTTCATGCAGAAGATCGACCAGTGCAATGTCATCTTTGACTTCAACGACGCCAGCTCCGACATGAAGTCAAAGG
AGATCAAGCGTCTGGCGCTTCACGAGCTGCTCGACTATGTCGCCAACAACCGACAGGTCATCACTGAGCCAATGTACCCT
CGTGTCGTGGAGATGTTCGCCAAGAACCTCTTCCGGCCTATCCCCCCGCCGGTCAACCCCCAGGGCGAGGCATTTGATCC
CGAGGAGGACGAGCCTGTGCTAGAGGTCGCATGGCCCCATATCCAGGTTGTCTACGAGTTCTTCCTCCGTTTCATCGAGA
GCCAGGACTTCAACACGAACATTGCCAAGGCCTACATAGATCACAGCTTTGTGCTGCAGCTGCTGGAACTCTTCGACTCA
GAAGACCCCCGCGAGCGTGATTTTCTCAAGACGACCCTGCACCGAATTTATGGCAAGTTCCTCAACCTGCGGTCGTTTAT
CCGACGCTCGATCAACAACGTCTTCTTCCAGTTCACGTATGAGACTGAGCGCTTCAACGGCATCGCTGAGCTGCTCGAGA
TTCTCGGCTCGATCATCAATGGATTTGCTCTGCCGCTGAAGGAGGAGCATAAGCTATTCCTTACACGCGTCCTCCTCCCG
CTCCACAAGGTCAAGAGCCTCAGCATGTACCACCCACAACTGGCGTACTGTATCGTCCAATTCCTAGAAAAGGATGCCTC
ACTGACTGAAGATGTTTGTCCAATGGCCCCACCGTAGACCTATCCGTGCTACTGGTATGGTTGCTAACCCGTCGCCAGGT
TGTCCTTGGGCTCTTGAGATACTGGCCAAAGGTGAACAGTACCAAGGAAGTCATGTTTCTGAACGAGATCGAAGACATAT
TCGAGGTCATGGACCCGGCCGAGTTTGCCAAGGTGCAGGAGCCATTGTTTCATCAGCTGGCCAAGTCCGTTGCCAGCCCG
CACTTCCAAGTGGCAGAGCGGGCGCTGTATTTCTGGAACAACGAGTACTTCTGCAATCTCGTGAGCGACAATGTGGAGAT
CATCCTGCCCATCATGTTTGCGCCTTTGTATGAGAATTCAAAGGGCCACTGGAACCGGTACGGAACCCTGTCGAGGATGA
TGACCTAGCATAGGTGCTAACATTGGTCGCAGAACGATCCACGGCATGGTTTACAATGCCATGAAGCTGTTTATGGAGAT
CAACCCACAGCTGTTTGACGACTGCTCGCACGAATATACAGAGCACCAACAGACGGCTGGCGCAAGGGAAGCGCTCCGCG
AGCGCAAGTGGGCGACGATCGAGGGACAGGCGAACCAGAGGAAGCAGGCCAACGGCGCAGACAAGGCTGAGCCAGGGGCA
CGCCCGCAGGGAGGCGGGATGCCGCGACTAGACGAAAACGATGCCGAGGACAACCAGAAACGGCTGGACTCGCTCAAGCT
ACAAGACAATGACCGCAATGCCCGGCGGCCGGCAACGGTGGCGGTGCGTGAGAGACAGGACTCGACGGGATCCCTGCTGA
ACCAGCGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62