GenePrediction:GLEAN_2597 Details

Name: GLEAN_2597
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2090426..2094930 (+ strand)
Length: 4505
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2090426..2090467 (+ strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_140:2090516..2094204 (+ strand)
Length: 3689
Type: CDS
Source: GLEAN
Position: GCSC_140:2094660..2094756 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:2094814..2094930 (+ strand)
Length: 117
>GLEAN_2597 class=GenePrediction position=GCSC_140:2090426..2094930 (+ strand)
ATGGGCCCTCCCGATGAAAACGGGCCCGATGGCTCATCCATTGTGAGTTCTTCGTCCAAGCTACCGCCTCTCCACGGCTA
ACCCGGACAGAAACCGGTCTCTTCTCTGCGGGCTCGCTTCGAGAACATGAGCAAGACCACTCCCGACTCCCTTCCCAGCC
AAACGACTCCGGCTTTGCCTCCGCTTCCCAGCCGCTCCATCTCGCCGGGACCCAAGCCAGAACGACTTCGCGATGCTGTT
GCCACGCCGACAAAATCAAACCGGCTGTCCTACACGCCGCTCCCGAAACCGAAGCCGGCCGTCATCTCGACTGCACATTC
TCAGGCCCCCGACAGCCTCAGTACTCTCAGGCCCTCCTCCGACCGCATCGGTCTGCCGCCACCGCTCAGCCCACGGCCCA
TCCCTCCTCCGTCTCTGCTCGTTCAGCCTCCTCAGTCTCCGCCCAAGGGACGCGCCAACCACATCGCTTCCGCGTCCAAC
GTCGAGCCGAGCACCTTTTTGAATCCGGACGCCGTCAAAAAAGGACCGCTGTCGCCCTCCTCGTCGCCACGTCCGTACAA
AATCCCAAGCCGGCCAATCACCCCCAGCAATGCCCTGGATCTGCTCAAGTCACCACGACCATCTCCGTCACGGGCCCCGT
CGCCACCGCCGCCGCGTCGCTCAGCCGAGCTGAAGCGCGAGCGTGAGCGCGAGCGAGAGAAGGACGGTGTGCATCATGCA
GCATCAGCATCAACATCAGCACTAATACCAGCATTCGCATCTGCATCTGCATCTGCATCAGTACGACCAGTGCCACCTTC
TATTGTGGGCCGTGCCGACAAGCCCAAGATCCCATCCCATCACATATCCTATTCCACCGTCGAGTCTGGCTCCCTGTCTG
ACGGCAGCAAGAGCGTCGCAGACAGCCGCTCGCCCTTTAGCAGTCCACCCAGCAGCTCAGACAGCCAGCTCGACGACCAG
CCACCCTCACTCCCCATGCGGCCCCGACAACAGGTACAGATGCAGGCGCAGCAGCCTCCGCCACGACCAAAGGTGGCCGC
CACAGCTCCGCGCACTTTCGAACCACCCCCGGTACACCACGCCGTGGTCAACCGACGCATGGGACGCGAGCAGGAAGCGC
CTGCCAACGGGTCATCACGGGGACCAGTTTCGTCCATGGGGCCACCACCGCTGCCATCACGTCCGCAGAATAACACCGAG
ACGATCATGCGAAGCCACAGTTCCGTATCCTCACGGTCCCGTCCATTAATCAACACACATCACGTCGGCGGCAGCATCTC
CTGCGGCATCTCCAGCGGCATCTCCAGCGGTATCAACAGCCTCGACTCATCCGGCCTGTCGTCCGCGCAGAAGAGAGTAG
TCTCGAATCCAACCTCCTCGACCCAGCAATTCCACCCCCCGCCCTCGCGGGCGCGCCACGGCCGGTCCATGACGGTAGAC
AGGAACGGCGGCCGGGTACCAGACGACACGCGCACACCACCGTCCTCTTCGACTTCCCTGTCGACGTCGGTTTCGGCGTA
CGAGGGCACGGCAAGCATCCGCAGCGCCAACACAGATGGGGCTGATAGCCTGATGTCGCCGTCAACTTCGACAAGGTCGA
CCGAGAGCCCAGCAATCACGTTTCCTGACGCAGCCAACGTCAACCGGCGGCCGGCGTACGCTAAGCAAGGCGTGGCCGAG
GTCAATGCGCGGTCGGACTGCCGGGTGTTTGACGTTTGCGGGGAGCTGGTCTGCACGACGGGTCACTTCACGCGGGTGTG
GACGCTGATGGACGGCGAGCTGCTGCTGAGTCTGGCACACGGTGAGAACGTGCGGGCAACGGCGATTGCGTTCCGGCCGG
GAGCACACGTAGACGACGAGGCGACACACCTGTGGATCGGCAATGCGGGTGGCGAGCTGATGGAGGTCGACCTTGCGGCA
CAGTGCATCGTGGCCAGCAAGCCGGGGGCGCACAACCGGCACGAGATTGTCAAGATCCACCGGCACTTCAACGAGCTCTG
GACGCTGGACGACGGCGGAGCGCTCTATGTGTGGGGGCCGGACGAGGACGGCGGCGTGCCCAGCCTGGGCGGCAACCAGC
ACCAGTCGTATCGGGTGCCGCGTGGCCACACGTTTTCGATGGTGGTGGACGACGAGCTGTGGCACGCGGTTGGCCGAGAT
CTGCGGGTATTCCTGCCGACGATGGACGGCAGTGCGCAATTCCAGGTGTCGGCGCGGGCGATGTGCCTAGAGGGTGCGGG
CGAGATCTGTGCGGGCACGACGCTGGTGTCGGACGACGACCGGGTGTTTTTTGGCCACGCAGACGGCAAGGTCAGCATCT
ACTCGCGGCGGGACTACTCGTGCGTCAGCATGGTCAGCCTGGGGTCCTACAAGGTCAACACGCTGCAGGGCGCGGGATCG
TACATCTGGGCGGGCTTCAACACGGGTCGGATGTGCGTGTACAATCCGGGGAGGTCGTCTGCGGAGCCGTGGGCGGTCAA
GAAGGAGTGGCAGGCGCACGAGACTCCGGTAGTCAAGCTGCTGGCCGACCGGGCGAGCGCATTCCGCACAGGACAGCTGC
AGGTGGTGTCGCTAGGGGCGGACAACCTGCTGCGAATCTGGGACGGGCTGCTGCAGGACGACTGGACGGAGGAGATGATG
CAGGACCGCGACCAAACGTACTGTGACTTTGACACGCTGCGCGGACAGGTGATGACGTGGAACGCAGGAGCATCGACGCC
CAGCACGTTGCGATACGCGGAGGACGATGCAAGGTTCATGCAGGACTTGCTGCAGAGCAGCGAGTCGCCCGACATTCTCG
TGTTCGGGTTCCAGGAGCTGGTGGACCTGGAGGACAAGACGGCGACGGCGAAGCGCTTCCTCAAGCCGAAAAAGAAGGAG
GGCGCAGACCAGGAGCGGATGAGCCACCAGTACCGCGACTGGCGCGACTTTCTGGTGCGCAGCCTGGACGACTACGTGGC
AGGCGAGCTGTACCACCTGCTGCAGACAGCACACATGGTCGGGCTGTTCACGTGCGTGTTTGTCAAGGCGGACTTGCGGG
GACGGATCCGCGGCGTGGCGAGCACGGAGGTGAAGCGCGGCATGGGCGGACTGCACGGCAACAAGGGGGCGATCGCGGTG
CGATTTCTGGTGGACGACACGTCTCTGTGCCTGGTCAACTGCCATCTGGCAGCCGGACAGTCGCAGGCGGCACACCGACA
CAACGACATTGCGGCGATCCTGGAGAGCGAGTCGCTGCCGGTAGAGCGAGACCTGGCGGCGCGGATCGACAACTTTGTGG
GGGGTGGCGACGGCAGCATGATCCTGGACCACGAGCTGTGCGTGCTGAACGGCGACCTGAACTACCGGATCGACACGATG
TCGCGCGACACGGTGGTGGCAGCAGTGCGGGCAGGCAACCTGACAAAGCTGCTGGAGCGCGACCAGCTGCTGGTGGCACG
ACGACGCAACGCGGCCTTCCGGCTGCGGGCCTTTGAGGAGCTGCCCATCACATTTGCGCCGACATACAAGTACGACGTCG
GCACGGATACCTACGACACGAGCGAGAAGAAGCGCAGCCCGGCCTGGTGCGATCGGCTGCTCTTCCGGGGTGGTCGAGCG
TCCCGTGTGCGTCAGCTGGACTACCGGCGGCACGAGGTGCGCGTCAGTGACCACCGGCCGGTGACGGGGCAGTTTGCCTT
TACGGTCAAGCGGGTGGATGCGAAGCGGAGGGCCGTAGCCTGGATGGAGAGCCAGCAGCTGTTTGAGGATCACCGGGATC
AGGTTCTGGATACAGAGAGGTGAGTGGAGTGGTGATGTTGTGGTTATGCTGTTGATACGCGTGACGACGAGAGCTGACAA
CTCAACTACAGAATGTACTACCTCACTCACGTCATCGGATACGACGAATCGACGAGCCGAGGACTAATTGACGAGCGAGC
ACCACGACGGACAACCCAGTGAAGCCCCAGCCGACACGGCGACTAAAGACCGATACGCGAGAAAAGACAGAGGTTGGAGA
CGAGAGCCGGGACGGGACTTACATGCGATGGGAAGAACCAACGTCTCGCGGGAAGGGAAAATCAAGTTAAACAAACGAAT
AATGGCAAACCCAAAATAATGAGTGGAGCTCCAGAGAGAAGCAGGAACAATAAAAAATGCACTGAAGCGGCCGAGACGGC
ACAAGGCGCGATTTGTCATCCAGCAGTCCAGCAACTCGTGCCGTAGAGAATGACCGTTTATGAACTCTGCACAGGCTGCA
ACAGGACTACGTTAGCCCCGACAACACCGGCATGTGGGACATACGCCAGACAATCGAGGTCGCCGAGATGGTGTCCGCAG
AAGATCTCGAGGTGGGCAACAGCAGAAGAGAATAAGACTTAGTGTTGCCAAGTGATATGCTGACAAAGCAATCCCACCAC
GTCTTCAACGGTGGCTTCCACAACCGCATCACCTACTACCTGCTGGTGCGGCTCTACTCAGGCTTCCTGCACCCGCCACT
GCAGCTACAATACGGCGTCAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62