GenePrediction:GLEAN_259 Details

Name: GLEAN_259
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:587385..591294 (+ strand)
Length: 3910
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:587385..587859 (+ strand)
Length: 475
Type: CDS
Source: GLEAN
Position: GCSC_167:587932..588140 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_167:588235..591294 (+ strand)
Length: 3060
>GLEAN_259 class=GenePrediction position=GCSC_167:587385..591294 (+ strand)
ATGGCCGATGTAGAAACGAGCAGCGCAGCTGTCGTCGCAAACGACAACGCGACGACGGCTTCACAGCGGCGGTCCGGACG
CGTTGTACGGCCTCCGACCAAGTACATGGCCGATGCCGTCCCGACAGCCAAGCGCAAGCGCTCGCTCGGCGACGGCCTGG
CGCACAGCGACGATGAAGCCGATGCGGCAGATGAGGACCTCATGAGCCAAAACGAGGACGGCGACGAGGCAGCCGATGAC
GACGACGACGATGACGATGACGACGATGACGACGGCGACGAAGACGAGTCCGGAGCAAAGAGACGGTCACGCTCTCAGAG
AAAAGCAAGCGCACCGCCACGGTCGGTGAAGCGCGCCGCCAAGAAACCCAAGCTCAATGGGAGCCACGCAGCCAGCCTTC
CGTCCCGGCCGAAAAAGACGGTTCGGGTTGCTGTCACCGTTGAGGTGGACGGCGATCATGGGAGCGAGCTCTACGGTATG
GTGCCTCTCGTGTCGCTGGCGCTGTGTCGCTGTGTCGCTGCTTGCGTTTGCTGACGTTCTGTGATAGCCGATATCTTTTC
GTCCGGTGACAACAGCGCAGATGTTGCTGCCCGATGGTACGAGAAGTACCAGGCTGGCAACCAGGTTTCTGTTGCCGACC
TGATCAACTGTATCCTCTCTGCTGCCGGATGCGACCACCACGTGACAGAGGACGACATCAATGACCCCGACAACTGTTCC
AACCGGTTGACGGAGCTACAAGAAATATACGAAGATGTAAGGGCGTCCTGACTACGGTTCGGCACCGACGTGTGTGCGTG
TAGAGCGATGGACAGGTTGTGCTGACAGCCGTTTCTCTCCCCCAATGCAGCAAAAAATTACCGAGTATCCATTGATTGCC
AAGTCGCGGTCATCCCGGTCATTCCGAGAGCTTCTTGTGCAGTTCTTCCAGTCGATGATCAACGTGCTACACGACACCGA
AGTTCTCTACAAACAGCCAGAACTGATGGAGAACGTGGTCCGATGGGTGGCATCGCTATCGTCATCCACACTCCGCCCCT
TTCGCCACACCGCAACGACTGTTGCCCTGGCTATGCTTGACGGCCTGGTCGATGTGGCCAAGAAGCTGGATGAGCGGATC
AACAAGATGACGCAGCAAGTTGAGACGCAGAAAGGACGGAACGGCCGGGCAAAGGGCAAGGACCCGAGACTCACAGCATT
TGAGGCCAGCCTGCGCGAAGCTGGCAAGAACCGGGAACGTGCAGCTGAGTTGATGAAGGAGTTCTTCGACACTGTCTTTG
TGCACCGATACCGTGACGTTGATCCGCGCATCCGGACAGAATGCATCGAGGCGCTTGGCTCCTGGGTCTGGCTGTTGCCT
GCTGTCTATAGGCAGCCCGAATACCTACGCTACCTAGGCTGGATGCTCTCAGACGGGAACCCAGCCACTCGCCAGGAGGT
GCTGCGACAATTGGGCCGGGTCTTCAAGCGGGATGCCGGCAAAATGGGCCACTTCATCGACCGCTTCCGCGGCCGCCTAA
TCGAGATGGCGACAAAGGATGCCGACCTGGGTGTTCGTGTGACAGCTATCGGCGTTGCAGAACAGCTCCGACCGTCAGGG
CTGCTGGATCCCGACGAAATCGACCAGGTTGGTCGGCTTATTTTCGACTCTGAGGTGCGGATACGGAAGGCTGTGGTCAA
CTACTTTGCCGACTGCGTCCGGGACTACGCCTCGATCAAGCTTGACGAGGTGGGTGGCGAAGAGACCATGCTAGAGCTTT
TTGGCAAGGGCCAGAACCGAACCGGGCAGCTGGACACACCCCGGCGCGACTGGATCTACGTCAAGAGCCTAGCAGACACC
ATGTACGGGTACGAAGTGCAGCTGGGTCTTGGCACTAAGAATGCCGAGCACACTTACGGCCTGGATGCTGCTGCGGAGGT
CACTGGTGCTGTTGCTCCGGAGACAAGCCGTCTTGCCCTGGCTACGCAGGTCTTGGTGGACAAGATTCCCGAAGTCGCAG
ACTGGGACATCCTGGCTGGCTACCTGTTATACGATCACAGCGTGGAGACCAAAGGGCGCGGCCGCAACAAGTCCAAGACG
ACGGAGACGACGTTCCGGGCTGCCGTAGCGCCAGATGAGAAGCAGGAAGCGCTGCTGCTGGAGATCCTCACGGCAGCGGC
CAAGGCGACTCTTGCCTCTGGTGTCCAGGGAGGCCGCCTCCGCAGGCGGTTTGACGGCGGTGCTCATGCCGGCTCTTCGT
CATCGGTGGCAGCAACGGCGCAGGCAGCAGCCGACAACACAGAAGCAGCAGCGATGCAGCTGGCGGCCTTACTGCCGAGG
CTGCTTCGCAAGTTTGGCGCCGAGCCCAGCACGGCGGTCACGGTTCTGAGGCTGGAGCAGTCGCTTGATCTCGCCGTGTT
CCAGCAGCTGCGACAGGACACTTCCACGTTTGAAGTTCTCCTGGACGAGGTCTGCACGCAATTTACGCGCCACGCCGACA
TGGCAGTCGTCTCCGAGGCGGCTGCTGCCCTTCTGCACGCGCGTCAGTACGATGAGCTTGAAGAGATTGTGGACAGCAGG
GTATCAGCGCTATGGGAGGCAAACATCAATTCGCTCCGCAACTTTGACAAGTCTTGTGAGCTCTCGGCACGCCGGAACCT
CAAGGCATCGCTGGCCACAGAGCTGTCGGTGACGCTGTTCAAGATCAGCAAGCTTGCATCCATCTCCGACTGCACGGATG
TAATGGAGGAGGAGGGAACCGGGACAGAGTCGACGTCACCGGCCATTGACATTCTCGTCAAAACACTACGCCGCGGCAAA
TTTGAGGAAGTTGACGAGGACCTCGATAACATCGAGGACGGTCTGACAATGCACGCCATGGCAGCCTGCCAGTTCTACTT
CATGTGGAAGATGCGGGCGATTGTCCTTTCTGTGGAGGCAAAGGCGGACGTGCTCAGCACGACGATCGATCGGCTGTCCA
TTCTGAAGCGTGACTTTAACCAGAATGTGATCCACACGTTCTCCTCGCGCGGATACAATGACGATCTGCGGCTCTACGCG
GTCGGTTCGTACTGCGATATGCACGTGCTATTTGCCAGTCTCCGCAAGCACCTGAACGAGCCGGCCACGATGGCCAAGTA
TGTCGGTCTTGGCCGGCTGATTGACCAGATACCTTCGGCGCTGGTGAAGGAGCTGGTGTCGGTGCTGGACGCGGCGGAGC
GGTCGTTTGCCAAGAAGAGCAAGAGGACGCTGAACGAGCCGGCCGAAGACGAGGATCCGGCCGAGGATCCGCTGGATGAC
GAGGATGAAGAAGAGGACGAGGAGGTGCAAGAGTCGGCAGAAGAGCGGCAGGCGGCCGAGATGAAGGCCGAGCGATCGCT
CTGTGACCTGACCAGCCACTACGTTATGGCCATTGTGGCGCGGGTACTCGACAGCTCGGGCTCACAAGCGGGCAAGCTGC
GGCGACGTCTGCTGCGCAACCAGACGAAGCTGGGCCACAGCTACAAGGAGATTGTGGCGTTCCTGGACGAGAAGAAGGCC
AGCGAAGTGCTGCTGGCAAACGGCCGGAAGAAGGGCGAGGCAAGGGTCACAGCCAAGGGCAAGGAGCCACAAGCGGGCGG
CGTGCGTCTGACGACTCCTGGTGCTGATGCGGATGCTGGTGTTGAGGCTGAAGCCGATGCTCTCGACATGGACTTGGACA
TGGATGCCAGCGAAGACCATGGAATCCTGATTGGAGCGCCGACACCGGCGGCTGATCTGGACGACGACGAGCTGAACGAT
CTGCTTGCCACGCCTGAGCCGGAAGAGGGCACGGAGGAGGATCTTCGACGGAGAGAGCTGCTGGACACGGCGCTGGACGA
GGAGGACGAGGAGGACGACGGCGACAAGGGCGGTAATAACGACGATGATGACAGTATTCTTGGGGATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62