GenePrediction:GLEAN_2604 Details

Name: GLEAN_2604
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2142870..2144320 (+ strand)
Length: 1451
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2142870..2143101 (+ strand)
Length: 232
Type: CDS
Source: GLEAN
Position: GCSC_140:2143209..2144320 (+ strand)
Length: 1112
>GLEAN_2604 class=GenePrediction position=GCSC_140:2142870..2144320 (+ strand)
ATGGCCGACACCATCAGCAGAAGCGACACCGTCGGCTCTCTGCTGGCCCACATTGCCACTGCCCTGCAGGACGCTCTGCG
CATACTCATGTTTGCCGACAAACGAAGCTGGGGCCGTGGCGAGTTCGAACAGGTGCGCGTCCTCGAGGAGACCCTGGCCG
AAGCCAAGCGCGACTTCCAGGCCATGGCGCCGCTCGTGAATGGCCAGTTCTATTACGAAAACGACAGGAGGAGTACGTCT
GTCTGGATTGGTCTCCGTGTCTTGCCGCGGCTTGCCGCTGCCTCCTGTTCCATTCTGTCTTTCTGCTTGCTGACGGCTGC
TGCTTCTTCCTCTCCTTAGCCGAATCCATAAGAGAGCTCCGAGCTCTGCGCGCACAATTCGACCGCCACGCCCAGACATT
CAAGGACTGGCTCCGTACTGGCGGACCTGTCAGTCCACTATGGGCTCGCGAGACAGTGGATCTGGGTCGCCAACTGCACC
GCGCGCAGTGCCGAGCCGCCCGCCGCATCTACAACGCCGAGCATGAGGATGGCGGCAGTGGTGCGCGCTGTCTGGGTGCT
TTTCTGGTGTACCGCCGCCTGCGCGAACAGGAGGAACGCCGGACGCGGACGCGCAGCCGCCCACCCCTCGAGCGGGTTCC
TACCTGGAAGCGTCAGCAGATGCAAATGCAGAAGCGCGAAGAGCAGCGATACGCCGGCCGTGAGCAGCTGAGCCGCGCCA
GCAGCCAAGACGACGGCGATATCGAGCTGTCCGGACTTCCGCCACTGGATCCGGAGATGGACGCAAAAAAGGCGACATCT
ACGATCGTCGCGGAAGAGACGGCAGGCTCATCGTCGTCGTCGTCGCCGTCACCATACGGCACAAAGCCAAGGCTCAGCCT
CGAAGACCTCGTGCCCGACTGCAATGCTGTCGGCACCTTTGAGCGCTTTGGCGACCAGGATGTCGTCTTTATCTGCGACT
TCTGCGACGGCCACATCGTCTGGGAAGATGTCCACCGCCTGCCACATACGCGAACAAATGCCTTGTCGTATTCGGCCGAT
CCCTTGTCACCGTCGGAATCGGAACCACGGCTTCCCTTCACAACCCAGGACACACAGCGGCCTCCAGTAGCAGCGCCACC
AAGCCCTCGCGGCCCAGACGACTACCCCCGCTGGCAGGCCACGGCCATGGCCTTGTCCAATAGAGACAAGGAGCGGACGA
TCGTCTTTCCCCCGTTGGCAATCGCCAACCATCTCCCACCCACAGGCGGCGACTGGGAGGCGCGGCTATGGTGCCCCTAC
TGCGACGAGTACATGTACTACGACAGTGCCGAGGGCGACAACACCAAGTACGCTCAGGGCGAGTTTGGCTTTCTCAGCCT
CAACGCTTTCCAGGAGCATCTGGAGTGGTATCACACGGCGCTCCCGATCCCAGCCCTTCCCGTGTCCTCGAACAGCTGCG
CGGTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62