GenePrediction:GLEAN_2607 Details

Name: GLEAN_2607
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2150487..2151585 (+ strand)
Length: 1099
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2150487..2151012 (+ strand)
Length: 526
Type: CDS
Source: GLEAN
Position: GCSC_140:2151071..2151585 (+ strand)
Length: 515
>GLEAN_2607 class=GenePrediction position=GCSC_140:2150487..2151585 (+ strand)
ATGGCCGATTCGGGCTACAAGAGGTCTTCGCGGCGACAAGATGGCGACCGTCCGCAGCAGTGGGATGATAGAGACCGCCG
AAATCGTGGTCGCGGTGGAAGAGAGCGCGATCACGACAGAGAACGAGACAGGGATCGAGGACAAGATCGGGGACAGGAGC
GAGACCGGGACCGGGACAGGGACAGAGACAGAGACTGGGCCAGAGACAGAGACCGGGACAGGGAGCGAAATCGCGATCGC
GGAAACCGGAACCGAGAGCGGGACTCGGATCGTGACCGCGACCGTGATGGAGATCGAAATCGGCGCTATCGATCACGCTC
GAGGGATCATCGCGACCGCCGACGGTCGAAGTCCCCGAGTCACGGAGCCACCGACGGAGTTGATGACAGAAGCAGTGGCT
TCAAGGACCGCGATGGCGGCAGAACGAAGAAGGCCTTTGGCGGCCGCGAGACTGAGCCACCACGAGACGAGCTACTAGCA
GCATCTGCGCCAAGGCAGGGCGCTCGTGACGAGACGAGAGACAAAGGTATGTGGATCTTCTGGTGAGCAGCGAGGCGCTG
GAATTTTTGTTGACGTCTTGGCAGAGCGTGGCGGACATGGCCGACGTCGGTCTGCGTCGCCGCGACGCGACGCGAGCCCT
CCAAACGCCAACGGCAGCAGCAGCAACAATGCTGGCCTGCCGACGCGGACGCGACCAGCAGACAAGCGACAGGAAGTGAT
AGCGACAGGGACGGCACCCATGTCGTTTCGCGTCGGGGCAGTTCACGATGCCGCCTACAAGGACGAAAACGACGGCGACT
ACGACGGCAGCCGTGACGATCGCGGCCGAGGACGCAGCCGACGGCACATCGACGGCAGCCCGATGGCCGAGGGCGACGAC
GATGACGACGACGACGACGACGACAACGTCCTGGTGGAGGACGACGGGACGATGGACGCGATGCAGGCGATGATGGGCTT
CAGCGGCTTCAACTCGACCAAGGGAAAGAAGGTGGCGGGCAACAATGCCGGCGGCGTGCACAAGGTCAAGAAGACCGAAT
ACCGACAGTACATGAACCGCGTGGGCGGGTTCAACCGGCCGCTGAGTCCATCGCGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62