GenePrediction:GLEAN_2608 Details

Name: GLEAN_2608
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2153333..2155001 (+ strand)
Length: 1669
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2153333..2153378 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_140:2153432..2154354 (+ strand)
Length: 923
Type: CDS
Source: GLEAN
Position: GCSC_140:2154420..2155001 (+ strand)
Length: 582
>GLEAN_2608 class=GenePrediction position=GCSC_140:2153333..2155001 (+ strand)
ATGATGCTCCAACGAAGAATCCGCCCGGTTGCGGCCCTTGCCATGTGTGAGTGCGTCTGAGCAAAGCAATCTTCCGTTCC
TGCTAACAGCCGACAGCAGCACTGGCCATGGCCGCTTCTGCAGCCACCGTCTCTTACTGTCCCTCGGGAGCCGACAACAT
CTGCTTCGCCGTTGGCGTGCCCCAATCGACTGCCAGCTCGGGCTCCGGCAATATCTACTTCAGCATCACCGCACCCACCA
GCTACCAATGGGTGGCTCTCGGCACCGGCACGCAAATGTCTGGCTCCAACATCTTCCTCATCTACCAAGATGGTAGCGGC
AATCTGACGCTCTCGCCGCGCCTCGGCACCAATCATGTCATGCCTACGCTCGACACGCAGAGCAATGCTGCCCAGCTAAG
TCTGCTGGCTGGCAGCGGTGTGTCTGACAGCACCATGACTGCCAACATCATGTGCGCCAACTGCGAGTCCTGGGGCACCA
GCAGCTCGATGTCGGTCACTAGCACTAGTTCGCCGTGGATTGCTGCCTGGAAGTCTGGTAAGTCGCTGGCCACGACCAAT
CAGAATGCTGCCATCTCTCAGCACGACAACACTGCGCAGTACAAGTTGGACCTCACACAGGCTGTCATCAGCACGGACAG
CAACCCGTTTGTGAGCGCTGCCAGCAGTGGCAGCAGCGGATCGAGCTCTGGATCTGGCTCTGGATCTGGCTCTGACTCTG
GGTCTGGGTCTGGGTCTGGCTCCAGTTCCGGCTCCAGTTCTGGCTCATCTAGCACTGGTAACACTGGAGGGTCGTCGACT
GGTGGTGTCACGGCGACCTCCAGCGGCTCGTCAACCCCCTCCATCCTGATTGCTCACGCTACCATCATGAGCCTCGTCAT
GGTCCTGCTCTATCCGTTGGGCGCGGCTCTGATGCCCCTGCTCGGTAACTGGCTTGCCCACGGCGTCTGGCAGGGTGTCT
CCTACTTGCTGATGTGGGCAGGCTTTGCCGTTGGCGTTGTAGTCGCCCGGCAACGAAATCTGGTGAGTTTCTCCGACTCA
CGGCTGATCCGATTGTCTTCATCACACGCTGACTATGCATCCACCAGCTCTTCGTCGGCCCTGCCCGCAACCACACCGTG
ATCGGCACTGTCGTTGTAGCTGCTATGGGCATCCAGCCCCTTTTGGGCTTCCTGCACCACCGCCACTTTGTCAGAAATCA
GAGCCGCGGCCTGGTCAGCTATGTGCACATCTGGTGGGGTCGCCTGCTCATCATCCTCGGCATCGTCAACGGCGGACTGG
GCCTCAAGCTGGCAGACGCGCCGAGATCAGCCAAGATCGGCTACTCGGTAGCCGCGGCAGTGCTTTTCCTCGCCTACGTC
GGTGCCAAGGTTGTCGGGACATGCTGCCTGGCAGGGCGCCGCGAGAAGAAGAGAGATCTGGGACCGCAGTTTCGGGGAAA
TGGTGGGCAACGTCGCAGCCACAGCATCAGTGGTCCTGCTGATGGCATCGAGACTGCTAACACATTCCAGGGTCACGGAC
AAAACCAGTACCGGAAGCAACGGCAACAGCCGAGTAGAGGGAACAGTCGCCGGAGCAGCCACACACAGTCCGGCAGCAAC
TACTCGTCTTCTCCGATGCGTGAAACCCCGATGCCGCCGTCATCTCGTGAAGAGCGGCACTATGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62