GenePrediction:GLEAN_2609 Details

Name: GLEAN_2609
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2155564..2156302 (+ strand)
Length: 739
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2155564..2155590 (+ strand)
Length: 27
Type: CDS
Source: GLEAN
Position: GCSC_140:2155767..2155872 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_140:2155954..2156177 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_140:2156240..2156302 (+ strand)
Length: 63
>GLEAN_2609 class=GenePrediction position=GCSC_140:2155564..2156302 (+ strand)
ATGCTGCAGTCTCTATCTCGCTCTGCGGTATGTCGTTCCATTGGCCGTACCCAGGAATTGGCCAGAAAGTGGAGGAGGGG
GGACCCAACCGAGCTTGTCGGCCGATCGGAGGTGGCCATTGGCAATCCGAGGACATGCGGTTTTTCTGGGTCACCCAAGG
CTACGATACAGAATACTGACAGCTCTTTGTTCCTGCTGTCCAGACCGCCCGCCGGGCACTCGCCACTGCGGCGCGCTCGA
GCCAGACGACGATGACGCGGACCACCGTTCAGATGCGGACGTTTATCGTGCCGACGGTGGCGCGACGGGGTAAGCGATGC
GGGGGGGATGGCGATTGAGAGAGAGAGAGACGGGGAGTGAATGCGCAAAGGGCTAACGTGCCGTCTGCAGCCGACTTTGT
CCAGGAGCTGTACCTCAAGGAGCTCAAGGCCTACAAGGTGCCGGCTGTGAAGCCAGAGGATGCCAAGGGCCAGGTTGCCA
CGTTTGCGCTGCCGAAGACGCCTGCGTCGCCCGAGGAGGCCGACCTGGCCAGCAGCCTGCAGGAGTACGAGACCATGGCC
GTCGAGGTCGAGGGCCAGGAAGGCCCGGCCGACGGTTCTGCCGTCGCTGCCCCGGTCGAGGACTGGCTCGTCGAGGAGGA
GGAGGAGGAGGACGCTCACCACTAAACAAGCCACAGCGCGCGCTGACGAATGACCGGACACGCGAGCCACGCTCGATGCG
GAAACACCTCTCACCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62