GenePrediction:GLEAN_260 Details

Name: GLEAN_260
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:594752..596538 (+ strand)
Length: 1787
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:594752..594985 (+ strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_167:595072..595581 (+ strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_167:595633..596538 (+ strand)
Length: 906
>GLEAN_260 class=GenePrediction position=GCSC_167:594752..596538 (+ strand)
ATGGCGGAACGGTACATTCCCGAGCATCGGCGGACGCAGTTCAAGGCGAAGAACACATTTAAGCCAGAGGAGCTGCGTCG
TCGTCGCGAGGAGCAGCAGGTGGAAATTCGCAAAGCCAAGCGCGAGGAGAATTTGGCCAAGCGCCGTGGTATTGGCAGTG
GTGATCAGCGGCCTGGTGCGTCGCTTGGTGCGGCCCCGGACAGCGACGATGACACGGCTCCGACTGAGTCCCAGGTAAGA
GTTGACTGTTGGGAGATACTGTTCTTATTGATTTTACTGCCGGTTGCAACTCAGCCTCACATGTACTGACGGTGTGACAG
CTGAACGAGGACCTCCCGCAGATGGTACAGGGCGTGTTTTCCGACCAAATCGAGCTCCAGATCCAGGCGACGACCAAGTT
CCGGAAACTGCTCTCCAAGGAGCGGAACCCTCCGATTGAGGAGGTGATCAAGACAGGCGTTGTCAGCCGGTTTGTCGAGT
TCCTCCGGTCGCCACACACGCTGGTGCAGTTCGAGGCGGCGTGGGCCTTGACCAACATTGCCAGCGGGTCGGCAACACAG
ACGCAGGTGGTTATCGAGGCCGGCGCTGTGCCCATTTTTGTCGAGCTGCTGTCAAGCCCGGAGCCGGATGTGCGCGAGCA
GGCTGTGTGGGCGCTGGGCAACATTGCCGGCGACAGCCCGCAGTGCCGCGACTACGTGCTGAGCTGTGGAGCGCTCAAGC
CGCTGCTTGCACTTTTGGGCGACAGCCGGAAGCTTAGCATGCTCCGCAACGCGACATGGACGCTGAGCAACTTCTGCCGT
GGCAAGACGCCGCAGCCGGACTGGAACACTGTAAGTGCGAGGAGACAAGAGGAGACATTGAACGACAGCTGACCAGCATA
GATTCAACCGGCCCTGCCGGTGCTCTCGAAGCTGGTGTACAGCCTGGACGACGAGGTTCTCATCGACGCCTGCTGGGCGA
TCTCGTACCTGTCGGACGGGTCAAACGACAAGATCCAGGCAGTGATCGAGGCCGGGATTCCGCGGCGGCTCGTGGAGCTG
CTGATGCACGCATCGACGTCGGTGCAGACGCCGGCGCTGCGTTCGGTCGGCAACATTGTGACGGGCGACGACGTGCAGAC
GCAGGTGATTATCAACTGCGGCGCGCTGTCGTGCCTGCTGTCGCTGCTGAGCTCCAACAAGGACGGCATCCGCAAGGAAG
CGTGCTGGACAATCTCAAACATCACGGCCGGCAACTCGGCGCAGATCCAGGCGGTGATCGATGCCAACATCATCCCACCG
CTGATCCACCTGCTGTCAAACGGCGATTTGAAGACGCGGAAAGAGGCGTGCTGGGCCATCAGCAACGCGACGTCTGGCGG
GCTACAGAAGCCGGAGCAGATCCGCTACCTGGTAGCGCAGGGCTGCATTAAGCCGCTGTGCGACCTGTTGGCCTGCCCGG
ACAACAAGATCATTCAGGTGGCGCTGGACGGGTTGGAGAACATCCTGAAGGTGGGCGAGCTGGACCGCCAGGCAGCCGGT
GAAGGTGTCGATGCCATCAACACGTACGCGCTCTTTATCGAAGAGTGCGGCGGAATGGAGAAGATCCACGACTGCCAGTC
CAATGCCAACGAGGAGATCTACATGAAGGCATACAACATCATCGAGAAGTACTTCTCGGACGAAGACGAGGCGGACGAGA
CGCCGGCCCAGGCCCAGGGTCCCAACGGCACGTTTGGCTTTGGAGCCAACGGCGGCAGTCAGGGCGGCTTCAACTTTGCA
AACGGCGGCGAGTCGATGGACATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62