GenePrediction:GLEAN_2611 Details

Name: GLEAN_2611
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2166397..2167432 (+ strand)
Length: 1036
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2166397..2166566 (+ strand)
Length: 170
Type: CDS
Source: GLEAN
Position: GCSC_140:2166625..2167432 (+ strand)
Length: 808
>GLEAN_2611 class=GenePrediction position=GCSC_140:2166397..2167432 (+ strand)
ATGACAAAGAAGACGGGCCCCACTGCCTGGGACGACGACTGGGAGTCCCAGGCCGACAAGGAGGATAAGGAGACGGGTGG
TGCACCGCTCACGGCGGAGCCCGTGGTGCTGTCGCGTGCCGAGCGGCTGGCCAAGCACAAGGAAGAGCAGAGACGACTCT
GGAAGTCTGCGTAAGTGTCGTCCCATCCCAACTCGGCTGGGCCGGCCTCCTGACCGTTGCCCATACAGAGATGAGCCAGA
GGACTTTCCGTTTCTGGCCGTGTCCAGCTCGATTCCTGTCGGCGCCATAGGGATCAAGCCAGCCATGAAGGTGCTGAGCC
GCAAGCCGGCGCCTCAGATGATCAAGCGGCGTGATCCGGTCACGGGCCTCGAGCAGCTGACGATACGTGACGATGCTGCG
GAGGCGGCAGCGGAGGCCGAAGCAGAGGCAGCACGGAACCAGCTGACACCGGAGCAGATGCGGCAGAGGCAGCAGCGGGA
GCGGGAGGAGAAGCAGCGCAAGTACGATCAGGCACGGGCCAAGATCTTTGGCGAGCCGCTGCCCAGAGGAGGAGCAGGAG
CACCGGCAGCAACAGCAGCAGGAGCTTCGACGGCGACAATACCGGCAACAGCAGCCGCAACAGCGGCAGCAGCAGGGTCA
TCATCCGTAGCATCGTCTCGACAGGTGTCGCCTATTTCTCCGGCTGGCGGCTACGGGAACAACGGCAACCGAGGAAGAGG
CAGGGGACGCGGTAATAACGGCGGTGGTGGCGGTGGATACGGGCGGCGAGCCCAGCAGGCCGGACACGCAGGCAGTGGGA
CGGCATCTCGAGAGCTCTTCGACCCAAGTTACCTGCCGCGGACGACGGGCCCGCATCAGAGACGGGGAGGCGGAGGTCCG
GGAAACGGCGGCAGTGGCAGCGGCAGCGACATGGGCTGGTCTCCCTCACCAAGCCGGTCAGGCACGCCGCGCGACGACGA
CTATGTCATCCGGGCACCTCGAGGACCAGACGGCAGCGGCCGTGGGGGCTTTGGGTTTGCCAGACGCGGCAGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62