GenePrediction:GLEAN_2612 Details

Name: GLEAN_2612
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2170524..2172790 (+ strand)
Length: 2267
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2170524..2170672 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_140:2170746..2172615 (+ strand)
Length: 1870
Type: CDS
Source: GLEAN
Position: GCSC_140:2172782..2172790 (+ strand)
Length: 9
>GLEAN_2612 class=GenePrediction position=GCSC_140:2170524..2172790 (+ strand)
ATGGCCTACATTGGCCGCCCCTTCTCGCAGCACACTCGCTTTCCCGAGAAGCCGTTTGATCCCAAGGCCGTCACGCGAGC
AAGCTGGACGCCAAAGCCGGTCAAGCCCAAACAAGACGGACCATTGGTGCAGTTCAACCGCCATCCAGAGTATGTCGAGA
GCGAGTGTGCGAGTGTGTTCATGACCGATGTGGAGACAGAAGCTGACAGAGCTGTGGTGCAGTGCACACGAGGTCCTCGT
CGGACAGCGGCGACAGGTCCAGATGTTGAGCCGGCGAACGAAGACGGCGATCAAGGCCGTGCGGGTGGTGCAGTTAGTCT
TACGCGTGCTGCAACTCCTCGGCGCCACGGGTGTGCTGGTGCTCATGATCCTGATCAGCCACCTCCCGGACCAGACGGCC
TGGGTGATGCGCATCACGGCCATCGTCGTCATGGTGCACTGTGTCTACGGCATCTATCACATGGCCAAGCCAGCGGGTGC
ACGCCCGCCAGCCTCGTCGGCCGCATACCAGGTCTTCTCGGCCTTCTCCGACCTCTGCGTGCTGCCCATGTACGTCTACG
GGCTGATGGCGGCGCGCAGCGACAGCGACGGCTGGTCGACGCTGCTGGCCAACAAGGCGGCACTGTCGAGCCTCAAGACG
GCCTTTTACTACACGCTGGTCGGCGCCGGAGCCCTGCATCTCGTCACGCTCTGTGTGGCCTGCTGGCTGGGCGTCAAGTT
CCGCCAGATCACCATGATGCCGCCAGACATGAACCCGCTCGAGGACAATCTGACGTCGCGCACCAAGACGGCGTTACATG
CGCGCAACAAGTCGTCCGTCGTCACCATTGGCTCGCTGCAGTCGGTCGACCTGGCCAAGGAAAAGGGCTTTGTGCGGCCG
CCGGCTGTGCCGTTTGCCCACACGCGCGGCAGCTCGGACGCAACCAGTGTGCGCACGCATAAGTCACGTGACTCCCGCCT
TGATCTGCCCAGCCGCTACCACCAGGTGATGCCGAGCAACAGCTCCGTGCGCAGCAGCGCGACCACGCTGAAGCGGGCAT
CCATCGCCAGCGGCCTGCCGTCCAGTACCATTGGCCGAGGATCCTACGCTGAGATCTCGCTGCACGAGTCGTACGCGCCG
CACTACAACAGCCGTCGCAGCGTCGTGACCCCCCCTGGCACGGCTCCGGACGGAAACACTACCACCAGTCCCAACGGATC
GACACCGCGCCAGACCAGATTCAAGGAGAACTGGTCCGGGGCAGACACGCTCTCGGACCGCACACAGCAGCGCAACCAGG
CCCTCAACACGCTGGTGCTCAACGCGTCCGGCAAGCGGCGCGACTACAACCCGGTCAACCAGAACTTTGACTTTCCCGAG
TCGGACGGCGAGGTGTCGGACTCGGACACGGTCTACCAGCGGCCCATCTTTGACGATGACGACTACGGCGACACCGAAAA
CCGCTACGAGAGCTTCCGCTTCGAGACCACCGCGCTTAACCGGAACAACACTGGCGTCAGTAACGGCAACGACGATGACT
TGCACCCGAGCCCGCTGCGGGCGAACCCAATGAAGCGGGCCAAGGGCTCCGTCACGCCGACGGTGTCGTCGATGACGTCG
GCAGTCAGCAGCAGCACCAGCGGGAGCGCAGCAGAGGCAGCGAACAACAACAACGCAGTTCTGGGCGAGCTGAGCCTCAA
CGACCAGCGGGTCAGCGTTGTGGATGCGGCCGATCTGGGCGATGGCACACAGGGCAAGTACAGCAACGCAGAAGACGAGC
CGGACGAGGCGAGCATTGGGCGGGCCTTGACGGGCAACGCGATGCCGCAGCAGCTGGCGACAGGGAAGAAGCGCTGGACA
TGGGCGCCGCGAAACCGTGACAGCAGCATCCAGCCCGAAAACGGCTTCTACAGCAAGCCGTACGGCAACCTCAAGGCGTT
GACGCCGCCCATCATGGTGGGAAAGGACGTGTCGAACGTGCCGGCGGGGCGGCAGGTTTCTAGCGGCAACGACTACGACC
TGGGCAGCGGCGTGTACAATGAGGCCGAAGGGGCGACGGCCGTGTTTGGGCGGCGTCATGTCAGCGGCAAGTTGGCCGAG
GAGGGAAGGGCGGTTCGATACAGCCAGGCATAGAGAGAGAAGGAGAAGAGAGGGAGAGGAGAAAGAAGAAGCAAAAAGAG
AAAGGATCACGGAGAATCATGTAATACCACGGCCGCTGGCTGGGACGGAGTTTGGGATTCTATGTTTATGTGTTTATGTA
TTATGTATGGTAGTCCAGAGAATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62