GenePrediction:GLEAN_2614 Details

Name: GLEAN_2614
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2185635..2187181 (+ strand)
Length: 1547
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2185635..2185694 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_140:2185798..2186423 (+ strand)
Length: 626
Type: CDS
Source: GLEAN
Position: GCSC_140:2186485..2187181 (+ strand)
Length: 697
>GLEAN_2614 class=GenePrediction position=GCSC_140:2185635..2187181 (+ strand)
ATGGGGGACCGAAAGCGTGTGGGCGACTATGTCATGGATTTTGTCCTCTTTGCCGGCATGGTGGGCTTTCCCCCCGATGG
AATGCAATGCACAATGTGACAGGCCGCTGACAGCTCTTTGTGCACACACACAAGTACGGGCCACGCTCTACTTTTTGTCC
AAGAACATACTCTCGTCATTTGCGACCAATCTCGATCCCGACAAGGAGAAGCACGACCAGGCGCGGCTCCGGGCACGGGC
CAACATCCAGCGGCTGCTCAAGGACCAGGGCGGCGACGCCAACGAGGCGGGCGGTGATGGAGTCGGCGAAGACGGGCTGC
GCGGGCTCCGGCCTGAAGACCTCGAGCTCAACGAGTACGAGAACATGATCGCGCTCGAGGTGGTGCCGCCCGGCGACATT
GCGGTCGGCTTCGACGACATTGGCGGCCTCGACGAGATCATCGAGGAGCTCAAGGAGTCGGTCATCTACCCCCTGACCAT
GCCCCAGCTCTACTCGCACGCCGCCCCGCTGCTGGCTGCCCCGTCTGGCGTCCTCCTCTACGGACCCCCCGGCTGTGGCA
AGACCATGCTGGCCAAGGCTCTGGCCCACGAGAGCGGCGCCTCCTTTATCAACCTGCACATCTCCACCCTGACGGAAAAG
TGGTACGGCGACTCCAACAAGCTCGTCCGGGCCGTCTTCTCGCTGGCCCGCAAGCTGCAGCCCGCCATCATCTTCATTGA
CGAGATCGATGCTGTGCTGGGCACCCGTCGGAGTGGCGAGCACGAGGCCAGCGGCATGGTCAAGGCCGAGTGCGTTACTT
TTCTTTTGCAGCTCCTTCAGACTCCGTCTTCATCTCCCTAACACGTCTAGATTCATGACCTTGTGGGACGGCTTGACGTC
GTCCAATGCGGCCGGCGTGCCGTCACGTATCGTCGTCCTCGGCGCCACGAACCGCATGCACGAGATCGACGAGGCCATCC
TGCGTCGCATGCCCAAAAAGTTTCCCGTCCCGCTGCCGGCCGCCAAGCAGCGCCTGCGCATTCTGCAGCTGGTCCTCGGC
GAGACCAAGCGCGACCCCAAGTTCGACATTGATTTTGTCGCCAATGTCAGTGAAGGCCTCTCGGGCAGCGATATCAAGGA
GATCTGCCGCGATGCTGCCATGATGCCCATGCGCGAGTATCTGCGCGCCCACCACGCGTCAGGCAACCCGAACTCGCAGA
TCAACCCGGCCGATGTCCGCGGCCTCCGCACTGACGACTTTTTCACCCACCGCAACATGGAGGAGATACAGACGCAGACC
CAGGTCCTGGCCCAGACCCTGGCACAGGCCCAGGCCCAGTTTCAGGCCCAGGCTCAGGCCCAGTTTCAGGCACAGACACA
GGCACAGGCACAAGCACAGGCACAGCCAAGAGAAAAGGGCACCCGCCGCCGTTCACGCCGCTCATCTGCGTCGACAAAGA
AGGCAGACAAGCCGGCAGCCACGGCCAATGGAGACGGCGATGATGACGACGACGCATACGAGGACGTGGACGACGACGAG
TCCCTTCAGGCTCTGACAGTAGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62