GenePrediction:GLEAN_2616 Details

Name: GLEAN_2616
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2192029..2193945 (+ strand)
Length: 1917
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2192029..2192109 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_140:2192169..2193202 (+ strand)
Length: 1034
Type: CDS
Source: GLEAN
Position: GCSC_140:2193259..2193392 (+ strand)
Length: 134
Type: CDS
Source: GLEAN
Position: GCSC_140:2193464..2193945 (+ strand)
Length: 482
>GLEAN_2616 class=GenePrediction position=GCSC_140:2192029..2193945 (+ strand)
ATGCATGAAGGGAAGTTACATCGAGCACGCATCGTGTCGAGCGTGGCAGCAACGGTGATTTCGCTAGCCTGTGGGACAAA
CGTGAGTGTTATGTGCATGTGTATGTGTGTGTGTGCCCTGCTGACCTGCTCTCCGTCCAGTATGTGTACTCGGCATGGGC
GCCGCAGTTTGCCGACAAGCTGCAGCTGTCGGCGACGCAGTCGAACCTGATCGGACTCTCGGCCAACCTGGGCATGTACT
CGCTCGGCGCGCCGGTCGGCATGTTTGTTGACGGCAAGGGTCCGCGGCCAGCTGTCGCCGTCGGTGCCGTGCTGCTCGGT
CTCGGCTATTTTCCGCTGCAGCAGGCCTTTGTGGCCGGCGCTGGCGCCGTGCCTGCTCTCTGCTTCTTCTCCTTTCTGAC
CGGTCTCGGCGGCTGCATGGCCTTTGCCGCTGCCGTCAAGACGTCGGCCCTCAACTGGCCGCATCACCGTGGCACGGCCA
CTGCCTTCCCGCTGGCCGCCTTTGGCCTCAGCGCCTTTTTCTTCTCCGTCCTCGGCTCCATCGCCTTTACCGACAACACC
GCCGCCTTTCTGTTGCTGCTCGCTCTCGGCACCGTCTGCCTCATCCTGCTCGGCTTCTGTTTCTTGCGCGTGCTGCCCCA
CGGCCATCCGGCCGCCGCCGCCGCTCCCTACGACGCCTTGCCCACATCCTCCCCCGACGCTATCGGCATCGACGACGACG
ACGATGACAGCCTCGCCGCCAAAGCCGCGTCGCGCAAAAGCCGCCGCGGGACTGCCGCCCGCAGCGAACCTGGTACGTTG
CTCTACACCGACAATGGTCGCGATCTCGGTAGCAGCGAAGCCGACGCAGCAGAAGCAGCAAACGACAAGGGCACAGGCGC
ACGCGAGCAGAAGGCGACCACCAGCACCGGCCCTGTCACAGCCTCGGTGGCCGCCGCCCCGTCGTCTGCTGCCCTCTCGG
AAGAAGATGCCGACCACGTGCCCATGGACGAGACGTCTTCTCTCATGTCGCGGACCTCTTCACTGCCCGGCGACGTTTTG
GTGCAGAACAGTGTTGATATGGATCGATCCCACCGTATAGACATCCGCGGTTGGAAGCTGCTCAGCAACATCGAGTTTTG
GCAGCTCTTTTCCATCATGGGCATCCTCTCTGGGATTGGCCTGATGACGATCAAGTGCGTTCTTTTGTCTTTCTTTCTCT
CTTTCTCGCCCCCTCTCTAACGGCCTACAGCAATATCGGACATGATGCCAACGCGCTCTGGAAGCACTACGACAGCTCTG
TGCCAGAGAGCCTGCTGGTGCAGCGGCAGCAGATGCACGTGGCCATTCTGTCCATCGGTAGCTTCGTGGGCCGTCTTTTG
AGTGGTACGTCACCGACTTTTCCCTCCTGTTCCCTTTGTCTCCGCATCTACGTATCCGTGCTGAATCGGGAGCAGGCGTC
GGCTCCGACTTTCTCGTCAAGCGGATGGAGGCCAGCCGGGTCTGGTGTCTGGTCATCGCGGCCAGCGTCTTCATCGTGGC
CCAGCTGCTGGCCCTAACCATTGTCAATCCGCACTTCCTGGCCCTCGTGTCGAGCCTTTCGGGTCTTGGCTACGGCTTCC
TCTTCGGCGTCTTTCCCTCCATTGTGGCCGAGTCGTTTGGCATCCACGGCCTGTCGCAGAACTGGGGCTTCATGACCCTG
TCGCCCATCGTGTCGGGCAACGTCTTCAATCTGTTCTACGGCTCCGTCTTTGACCGGCACACCGTCACCGGGCCCGACGG
TGAGCGCTCGTGTCCCGACGGCATCGAGTGCTACCGTGCTGCCTATGTTGCTACACTGGGTGCCTGCGGGCTCGGCCTCG
TGGTCACGCTCCTGGTCATCCGGCACCAGTACCTGCAGCGGCTCAAGGACGCCGGCAAGCGCAGTCTGGAGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62