GenePrediction:GLEAN_2617 Details

Name: GLEAN_2617
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2194518..2199046 (+ strand)
Length: 4529
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2194518..2195768 (+ strand)
Length: 1251
Type: CDS
Source: GLEAN
Position: GCSC_140:2195819..2195838 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_140:2196876..2197066 (+ strand)
Length: 191
Type: CDS
Source: GLEAN
Position: GCSC_140:2197513..2197622 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_140:2198574..2198726 (+ strand)
Length: 153
Type: CDS
Source: GLEAN
Position: GCSC_140:2198909..2199046 (+ strand)
Length: 138
>GLEAN_2617 class=GenePrediction position=GCSC_140:2194518..2199046 (+ strand)
ATGGGATTAACAGCCATCGGCACAGGGCTTGGGCATGCCACTGTTGCTTCGGATGCATCGGGCCCTGTCCGGTTTATGAA
CCCTACGACGCGCTATGTGGCCGTTCCAAAGGTGCATGCGGGCAGCGTGGCAGCAGGGAGAAGTGGCAAGAGAGGAAAGA
AGACGGCCGAACTGCCACAATGCACATCAACGGCAACACCGGCGTCTCCCAAGGTGCGACACCAGGTGTATCACATCTGG
CGCAGCCGAGACAACCGCAAGGGACGACATGCCGTCGTTGTCAGCCGGGCATTTTACCTCCATAGTCTCCGTCAGCGCAT
CCACGATCTCGAACACGAAGAGAAGAGAGCAGCGGCAGCACGCCACGCGGCAGCTCTACGGGCCACCAGCTCGCTGCGGG
AGACGCTGCGCGGCATCGGCAAGATGGCTGTGCGCTGGCCGGTGTGGGACATCTCGTTCGACATTGCCCTGTTCTTCACG
CTCGGCTCTGCCATCTGGGTCATCAACGCCTTTTTCGTCTGGCTGCCGCTGCAGGCACCTGCCACCAGCTTTGCCAACGA
ATCGGGCACAGGCGGCGGTACGACTGCGCTGGCCGGTGGCACCGTCTTTGTCGTCGGCGCACTGCTGGGCATGCTCGAGG
CTGTCAACGAGAACGACGGCGACTGCTTCGGCTGGGCCCTCGAGGAGGCCATGGCCACCGTCGGGACGAACGGCAACCCG
CTGCTGCTGCTGCTGCTGCCACGTCCAGACGCCTGCCGGCACCACCAGGCGCAGCGATGGCGGCTGCTGGGCAGCAAGGC
CGAAGACGACACAGCAAATGGAGCCCGTCGCCGCCAATGGTCTTGGTGCCCGTCGTGGCACGAGCTGCGCACGCACTACC
TGCACGATATCGGCTTCTGGGCCTGTGCCATCCAGGTGGTGGCGGCCACGATCTTCTGGATCGCCTGCTTCACCGGCCTG
CCGCCCGCCTTCGACCGGCTCTCGCTGGCGGCACAGAACGGTATCTACTGGCTGCCCCAGGTTGTCGGCGGTACCGGCTT
TGTCGTCTCCAGCCTGCTCTTCATGCTGGAGACCCAGCCGTGCTGGTACCGGCCGGCTCCGGGCCTTTTGGGCTGGCACA
TTGGCTTCTGGAACCTGGTCGGCTCCCTCGGCTTCACGCTGTGCGGCGCCTTTGGCTTTGCGGCAACGCAGAGCGCCGAC
ATGAACTACGCGGCCGCGCTGTCCAGCTTTATCGGGTCATGGGCATTTCTAGTATGTCGGCTTCCCATCTGCTTCTACGA
TATGCTAATAATGGCGTGCAGGTTGGCAGCGTGATTCAATGGTATGAAAGCCTGGACAAATATCCAGTGACAATTAAAAG
CTCAATACGCGGCGAGAGCCTGGACTAGCCTAAAAGTTTGTTGCATATTCTTGTAAAGGTGTTAATCTTGTCATGCCGGG
TCTGGATATACTCAGCCCCGTGTGGAATCTGATAATTTGAAATGGTCCAGAAGCAGACTGACAACAAGCCTCAAGCCTAC
AGCAACATTACCGACAAGATGAGATCGATCCGCACATACTCGACATGCTCATGCAACCTTGTACCGAGGCCCTGGACTGT
CAAGCTGCACTGCTGCCGGTTGCCGAACTCTTACATGTGATCCATGTGATCCGTAAACATATCGGCGACCTGGTCCACGA
CCGCTGGCTAGTAAAATAACAGGAGCAGTCCGCAAATCTTAGAAACCACATACATCTCAACTCTGGTTCACGGCTGCGCA
ATCGTCCTATGTGAGCGGCCGCCCCGATCATGGTAACACTCGCATGTCATCAGCTCATTTGTGCATGTTGCGCGTATTAT
CCTATCTTTTACGGAGTCCAGAGGCCATGAAACAGGCCTGGCTGTACATCGTGTCCTGCGCCACAGCAAAAGCCAAACCG
GAAGCGGCAGCGGGGCCTATATCAGGCCTGTATATACGTCGTAGGGCAATTGCTCAACAAGACAGGCGTGAAGGCTAACC
ATCTATAGTGGAAGGTGCCTATTTGTCTAGCGGCACCTGCCGCTTTCCGGACTCCCCGCCGTGCAAGGAAAACGGCTTTG
CACATGCTTCGGAGGACAGCTTCAAGACAGTCTCCACATGGCCTGGCCAGCCAAATGGTCCGCAGGCGGCAAGGGAGACA
GTCAGTTCGACGAGTGCTCGTACTCACTATGTAGCATCTAACGGAGCACATAGTACGAGCAAGCCGCGTCTCGCTAGTGT
GAGGCAAAAAGCAGGCCAGAAATGGCGGTATATCGGCGCGAACAGGTTCCAGACCGAGGAGAACTCGTCAGTTCGCCAGA
CTGGCCTAGCGAGACATTCAGAGACGACATGAAGCCAGCCACAACGCCACGGGGAATTGGGCCCGGTTAAGCGCAACAGG
AGGTTACACCCTTGCGTCCTCCTTGCGTGCTGCTTCGGGTTCTCGTCTCCTTCCGCCGGCGGCAAAAGGGGTCCAAAGGA
GACGCTGCCTGGCCGCGGCCGACCGCGACTGTGGTACTGGGTCGCTTCTGGATCGGTACTGCGTACCTGGTAAGTAATTT
ACAGTGCCGGTTGGTTGTCCTGGCAGTGCAATGATTGCAAAGATTGGCAGCAGATGGAACGTCTGTGGTCACACCCGGGC
TGTGTCCCACTCCGAAATTGGAACACGACGTGGCCAAGAAAAGGAAGTACGGGGTCGAAGAAGCAGAAGAAGGTGGCAGA
AGAGCCTGTCAAGGCCAGAGAACATGCCACACCGTACTCACCGCTGGCCCACTCGCCATGTACCCACGGTCAGTAACCAG
ACGTCTGTTTTTCCGGTTGCCCAGAAAAGGGGCTAAATCGGTCGGCAGAGCACCTGCCATTGGGCACGGTGGCATGCGAC
GCTCTTGCTTCGATGCGATGGGAGAGGACGGAGTGCACACGCATCGCGACTAGCTGTAAGATACTACGGCGTATGTTAGA
TACGAAGTACCTGTCATTCTTCTTGTAGTACGGAGCACTGCAATTTGCGGAGCCTCTTGACCCGGAGACCCCCATCAAGG
CTGAAAAAGCAAAGAAACATGACAGCCCCATTGTTGCAGCAGCGTTTGGATTACAGCTCACTCCAGTACGTCGTACGCCG
ACGGCCAAGAATATACAATGATTTCCATCACATGAAGGAGCCATACCCTGGGAAATTGCGCAGGGAGTGAGCATTTTCCA
GAGTCTGTTGCTGCTGCTGTTGCTGTTGCTGTTGCCGTTGCCGTTGCTGTTGCTGCCGCTGTTACATTCGCATTTAACTT
CGCGTCTGCGACTTACGAGGCCTCATTCTTCTTCTTTCCCACGCATGTTTCCTCATTCCCTTCTCCCCACATTCAGCTTC
TCCGGTGCGGAGTATTATACGGAGTACGGAGCTGTACGAACATATAACTCTTACGGATACCGTTAATTCGAGACATGTAA
TTGGTTAATCTCGGATGTCCAAATTCGAGAGGCAAAAGTATGCAAAGCGGATCGAAGAGAAAAAGGGGGGCCACTCCCAC
GCAGTGCCGCGTCTATTATTTCCCACTCATATCTCTCTATCTGAAGAGGACAGGGGTCAGGAATTGTCCGTACTCACTGT
TCCAGCAAAGCCTAACTTCTCTCGAAAAGGGGGACGGCGCTTTTTATGAAACGCAGTTCCGACGACCGGGATTGACAAAA
AATACTGCTCTCGACGGTGCGTGCAGCCAGTGTCAGCCTTCGGGGCCTAAACAGGGTGTGCTCGGGGAGCAGGAAAAAAG
ACCACACCGGTCCAGGGTCGGGATGGACGGACGGGCTTCCATAGACGCGTCCTTACTCGCCAACACTCTCGTAAGATGCG
ACGTACATCTCAGCACACGTCTCTTACAATGGCAGCGCTCCAGTGATTGTGGCTCTCCGTCGGGGTGCATGAGCCGGCCT
GGGTACCGCGCTCGGTCCTCGCCAACATGCCGACACAGATGGGGTAGTTGAGTCGAGTCGCTCGTCTCCGGCAACCCTGC
TATCGAGAAGCCACTGCTCGTACTATGTATGTACGGAGTACGACGTATGTCCATAGTACGAGGCGGAATGCCCGTGCAAG
TACGGATGCCAGCGCACGTACGATGAAAAAGTCGTCCAGGCAGACTGCACGGATAGCGACCAGGATGACCTGGACCTGGA
CCCGGACCTGAAGCTGACTGAAGCTGAAGCTGGACGTGGCGACGACGACGTATGGACCCGTATCTAGGTCATCGTGGTTA
CAACTGTGTCCGTACATACGACGTAGTATGTTCGGTCCCCGTTGCAAGGCACACGCGCTGCATGTGTGCTGTGCAGATGG
TCGGCTGCACATCAATGTACCGGATATACGACGTGGAAGCCGTAATCGCAGAATACGATACTCGCACATAGACGCGATGT
AGCCCTGGCGGCGGATTCGGTGGAGGCGTTGCGCAGCCGTGGGATGAAGAAGAGGCTGCCGTGCTCTGCAACCTTTCAGG
CACAATTCTTACGACCGAGATCCCTGCTGCCGTTGGCTGCATCGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62