GenePrediction:GLEAN_2618 Details

Name: GLEAN_2618
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2201915..2206371 (+ strand)
Length: 4457
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2201915..2205227 (+ strand)
Length: 3313
Type: CDS
Source: GLEAN
Position: GCSC_140:2205296..2206371 (+ strand)
Length: 1076
>GLEAN_2618 class=GenePrediction position=GCSC_140:2201915..2206371 (+ strand)
ATGGCTGTGTGGGAAACTGATGATGAGACCGACGGGCCGATCTTGCCTGTGACAGCGGCACTACCGACGCCGGCAGACAC
GCCATACCGAACACGATCGCGACCGCCATCACGAACTCCATCACGAACCTCAAAGAAGTCGCGTCGATCTACCACCCCAC
CACGGCCTGCCACATCGCCGCCCCCGATACCCGGAACGGACAAGACAGACAAGACGGACAAGAGCTCCAAAAGGTCTTCA
AGGGACCTGGCTTTCGACGACACCATCAGCATTCTCGACCCTCGCCGATTCACGCCAACTCTGCACGCCAACCTCGTCTC
TGAGATTCTTTCTCTTCGTCGCGATCAGGAGGAGAAAGTCAAGATCATCGAGAGCCTGGAGGCTGCCTTGCAGACATCAA
GAGAGGAGCAGGATGCACTTCAAGATGCCGTCGCTACAACTTCTAAGGAGAACCGGCAGGTTAAGCGTCAGCTGGCGCTG
CTGGAAGGCGGCACGTCCACTGCTCTGAGTGAACTCACCCGCGAACGGGACGAGGCTGCAGAAACAATCAACGAAACAAA
GAAGAGGCTCGAGGCAACACAGAAGCGGCTTCGACACTGCGAAGAAGACTCGGAGCAGACGCATAAGCAATGGGCCCGGG
AAAAGGACGCCTGGGATGAAGAGAGACGAAAGCTGGAACGGAAAGTACACGTCGCCGACACTCGGCTAAAGGCGGTCATC
GACGAGGTTGCTGCCTTCCAGGCGGCCGAGATGAACGCGACCAATGGCAACAACAGCACCGAGAGCGAGGCCGAAGAGAT
GGCGGCCGGCAAGGAAGCTGACAGTGCAAGCGTGCGAACCATGAGCCCTACAAGCAGCATTCGCTTCTCTGTCATGTCGG
GAAAGCTGAACAGCCATTCGCTCGCCGACGAGTTAAATTTTGACGGAGACGACGACTACGAAACCGATACTGGCCGCGAG
AGCGTGCTGTCAAACCACTTCCACGTTCGCAATCCCAGCCGAGACAGCCTTCTGAACCGGGCGCATCGCCGCAACCAGAG
CAACGACAGTGTCCGCAGACCGGGAAGCGTGGTGCGTGGCCGTTTCCTGAACCAGTCCGTGTTGGAGCGGCTAGAGGGTG
TCATAATCCGTGAGGTCGAGGAAGAGCAGCAAATTCCGGTCGCAGAAGTGCCCGTTGTGCCTGTGGTACCAAAGGTCGAA
TACACGGACTCGGCTGTGCAATACTCGCCGCCTCCTTCACCCAAGCTACTTCCCCAAACCCTCCTGACTATAGGGCCTAT
ATCGGAGGTCTCCGTGGAACCGTCGGTAGAAATTCCCGTGGCCCAGACACCACCACCGATCCCAAGCCGTGCGGATCGGA
TATCGCTCAGCGATGCCACGTTCGAGATGCCGACTCGTGGCGAGTGGGTCGAGATCGAAGCCAACCAGCGGCGCAAGAGG
GTGCACATAGCACGGACATTGACTATTGAGCCTGTGACGATGAGCAGCAGCCTGATGGTTTCTGTCGGATCGCAGACAAG
TACAGAAATGCCTCTCACGCCGCCCAAAACACCAAAGTCCCCCCCGTTCGAGAGGGGACACTCGAAGACCCGGACATCAC
CAGGCTCTCCTGCCGAGTCTCTCAAACCGGCACAGGCGGTTCTCGTATCCGCCTCGACGCAGACAGATCCGCCGTCGCCT
CCAGCAACACCGCTGGCCACGCTGTCTCCGATGGGTCTGGTTCCGCTGGGACAGATGCCTATCCCGATCATCAGTATACA
CCCGCCAACAAGCCGGCCGACGACACCGCACGAGCCGCTTCTTCCTCCGCTGTTCAAAGACTTTGGCTGCCAGGTGCAGC
TTGCAGCGCCTTCGTCGTACACGTCGACGTCTGTGCAGACAGATGAGATCCGAGTGGACAAGCGGCTCGACCGTCTTCCC
GCACATCTCCACCCGTCGGCCATCACGTCGCGGCCGTCTTCGCCGGGCGCATTTATTGTCGATCCGGCAGCAGCTGCGGT
AGATGACCTGAGCAGTCCCAACCCGCCAGCTCCTGGCTACGTGCCACCGCGAAACCCCAAACGGTTAACGGCCCGCATCA
GCATGGGCAACGAGCCTTCGTCTCCGCCAACGCAGATCCCGTTGTCGCCCATCTCCCTGGAGACACACGATGCCTACCCC
GGGAACAACGATGATGGGCCGCTGTCCAACCAAAGGGCACCGATGCGTCGGCCCCACCGTATCAGCAGTCTGTTTGCAGG
GTTCGACGCGATCAGCTCGGACGAAGCAGATGAGTTTATGGACGGCGACCTGAGTGACTTGGAGTTCCAGACGGCGCTGT
CAGCACCGAAACCACAATCGGGAAGCAGCTCAACGCGCACGAACGTTAAGCGGAGCGGCGGTCTGGCCAGCGACACGACA
TCCCCTGAACAGCCCGTCCCGCTTCCACGGCGCAGCTCTTCTCGAAACACGACGCGGTCCAGCATGATGGGCATTGGTAG
TGCGGAAACGTACGGCAGATTGCCACTGCGCGAAGCGAACCAGGACAGCCGTGATCCCGTGCTGATGCGGAGACAGTCCA
TCAAGGGCTCACGGCTGTCGTATGACAAGCCAAGCAGCCGGTCGAACGGGATGCGGAAGGCGGCGATGATCCAGAGCGGC
ATCGCTACACACCAGGGCCGGTCACGCAGTCCGAGTGTGACCGAGGTTGCCGACCCTCCGTTTCCGATTCCGACGCGAGC
AAGCTCCCGGAAGCCTCCTGTCAGTGTCAGTGCGCCGAGCGACGGCCAGCGCAGTCCGACACGGGAGGCCTGGGCGCCGC
GACGGACTAATAGCCGCGGCGGCAACTACCGTGCCAACAGCATCCGCAAAGTGCGGTCGGCTGCGGCAATCCCGGTCAAG
CCACGGCACGGGCGGCGTGCAAGTCGGTCACCGCCGCGTCACGTGCCCTTTTCGGCCGACGACGAGGAGCCCGAGAGCCC
TGGCCTGCCGCCGCTGCCGAACAACGACTTCACGGCGACGTCTCGGGCGCATTACCGCTCGCACCGGCACCAGATGTCGA
CAACCACAACGACGACAGACGTGACGGGCAGCAGCGGTAACCAGACGACGGGTGTGGTGGATGCGATTGCGCAGACGATG
GTGGGCGAGTGGATGTACAAGTATGTGCGGCGGCGGAAGTCGTTTGGTGGTGCGGACGTGTCGAACCGCGACGACAGCAG
CAATGACCGGCACAAGCGGTGGGTATGGCTGGCGCCATACGAGAGGGCGATTCTGTGGAGCAGCAAGCAGCCGTCGAACA
ACAGCATGCTGATGGGCAAGTCCGGACGCAAACGTAAGTGACTAACTATCTCCATCTCCATCTCTGCTTGGTCCAAGATG
GCAGTCTAACATGTCTCACAGTGACGATCCAGTCGGTTCTCGACGTCAAGGACGACAACGCGCCGCCCAAGGGCTGTGCC
CAGCTGTTCAACCGGTCGATCCTGATCCTGACGCCCCAGCGAGCGCTCAAGTTTACGGCCACAACGCCTGAGCGGCACTA
CCTCTGGCTGACATCGCTGTCGTTCCTGGCCCACTCACAGCAGGCGGTGCCGGAGAACATTGCGATGCCACTGCCCAAGA
CAGCGCCAGACTTTGAACTTCCGCGGCCCAAACGGCGAAACGGGATCCGAGACTCGATCCGGCTGACCAAGAGCAAGGGT
GCGCTGGTGCAATCGAGCCTCGCGGGGGCTTCGATCGCAGTGCCGGCATTGCCACCACCACCACCACCGATGAGCGTGGC
GTCTTCGCAGACAGATTCGATGCCACCCAGCATCCCGAGTTACCGGCCGGCTGAGTCGACGGTGTCAGCGCCGTCAGTGG
CGCCGTCGATTTCGACGCACCAGCGCGACATCTCGCGAGACACGGCCGAGCCGCCAGTGATTGCACGGTACCACGACCGG
TCCAACAACACGGCGATGGTTCACGGACGCAAGCGCAGCAACACGGGCGGTCACGTGCCACCACCACTGTCGTTCCGGGG
CTTTTCGGGTCCGGCAGGGAGCAGTAGTAGCTACCACCAGTCGACGAACAGCACGGCCGGACAGTCGGACATCTCGCAGT
CGCAGGCATCGACCAACGTGACCTGGGGCATGGTCAACGGGGCAACGGCGTTGAGCTCTCAGCGTACGTCGGAGGCATCG
TCACGGCCGAGCGGGCCGGTGATGAACAACTTCTTCGACGCCATCGGGACAGTGCGCATGGAGGCATTCATCAGCCCGCT
GGCGATGCCACAATTTGACGAGTATCCGGGCGAGCAGGAAGAGGTGCTGTACCGGGCACGGCGGCGCAGCAAGGACAAGC
GGCGGCGTGCGAGCCGAAGCCGTCATCGTGACAGCTACACGTCGCGGGGAACTCGTGGCACCGACGACTTATATGCCGGC
AGTCGTACAGGTGGTGATGAGGATTATTTCCGCGACGACCCCTTCAGAGGGTTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62