GenePrediction:GLEAN_2629 Details

Name: GLEAN_2629
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2259947..2262253 (+ strand)
Length: 2307
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2259947..2260142 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:2260314..2260567 (+ strand)
Length: 254
Type: CDS
Source: GLEAN
Position: GCSC_140:2260669..2260915 (+ strand)
Length: 247
Type: CDS
Source: GLEAN
Position: GCSC_140:2260998..2262253 (+ strand)
Length: 1256
>GLEAN_2629 class=GenePrediction position=GCSC_140:2259947..2262253 (+ strand)
ATGGCACCAGTGAAGGGTGGGCGGTACAGTGCTGGATCACTAGAAGAGCGGACCGGAGGACAGACCACACAGCACAGCAG
CGAGTCCAAGGAGGCGCTATCAGAGCAACGAGTCCGACGACGAGACGGCAGGCCAGGACCACCGAGCAGGCTCCGAAGAA
GAAACCCTGACAGCAACTCCAATGGCGATGTTAGCGGTGCCAACGGATCTCATAAAGACAACAGCCACGGCAAGGCTAAC
AGGGAAAACGACGACGACGACGACGGAAGCGACTCTGACGGCAGCGATGGTAGCTATAACAACGACAACAAGGACGGAAA
CAACGGCAAAGGAAACGGCCACGGCCACGGAAGCGACAGCTATCCAGCCGCCCTTAGTAGCGTTGCAGCTGACAGCATTA
CAACAAGCAGCATTTCCGGGTTCTTCACGCCTTCCAGCACGAGGAGCAGCACGGCCATCGCTGTAGCCAGCAGCAGAGCC
AACGGCGCCGACTCCGATAGAAATGGTGCTCAGCAGCTCACGCTCCAGCCGGCCATAGTTGCAGCGCCTTCAGTCACAAG
CGCCGAGGTTCTGGCGCCTGCTGTGACAACAATCGTCCTGGCCACTATTGTGACAGGGCCGGTGCGTCTGCGTGAATTCT
AAACCATTCTGTGTCGAAGCTGACAAGCCAGTAGAACTCTGTTGTGACGAGCTTTATTCCCCTCTTGACAACAACGCCAC
AGACAACCCTGCTGAAGTCTACTCTGGTGGCCACAGTTAGCGCTTCTTCCTCTTCTGCCTCTGACTCGGCCATGACGAGC
ATACTCACCAGCTCTGACAGGAGGCACAAGACGGCCAGCACCGATTCCGATTCCGACGATACCAGTAGTAACAGCAAGGG
AAACAGCAGCAGATGGTCGTCCCACAGATCGGATGACAAGCCGCTCAGCCAAAGTGCCGAACGAGCACTGATTTCGGCTG
GCTCAATAGGTAAGGGAATGCTCCTTGCCAACATGCCGACTTGCGTTGTTGTTTACCCACGACTGACGCAAGCTTTTTCT
CTCCTTTCCAGGTGCCTTCATCATCGTCTGCTTCCTCTTCTGGCTCGTGTGGCGAGCGGTCCATAACCAAAACTGGCGAA
AGCATGCAGGCGCGTTAGCTACTGCTGCAGTGTTTGCTGGCTCCCCTGCCTCGCCGTCTGCAGCAGTGGCCATCCACAGC
ACTTCCAACAGTGCCACCACGCCACCCCGCCGTCTCTTCAAGAGTATCACTTCTCGGATGCCTTTCTTCGGACGCCGGAC
TAGGACGTGGCAGACGCTCGAAGACAACACGAGCAAAGAGACCAACGCAACTGTTGGCACCAAAAACTTGGGGCCATCGC
AGCAGCCAGCCGAGGTCTACCAAGAGAAAATCACAAACATCGTCAGCAGCAGTGAGGGCCTTCCTGCCACACCGTCCCAG
GTGTACCATGGCGACGACCTGAGCCAGCAGAAGGAGCAGCAGCAGCGACAGAAGTATGCAGCCGCTGCCAGCACTGCTCC
GTCCTTCATATACTCGCAGCAGATGGCAGTTACCTCTGCAAACCTGCTTGCAGTTTCTCCATATGGCGCTGCTGAGGCGT
CTGCTGGCCCTACCGCAGAAGCTGCCTATCTCAGGGCAGGCAACGGCACCTTGATCAATAGCGACGGAGTCAGCTCCATG
GGCGACACGTTGCGGTCACGCATGCCCGACCCCTACTATAATCAGTCACAGTTGGCGCGCCAGCCTTCCGACGCCTACGA
CCCGATGCATCGCCAGGTCAACCGGATCTCAGAGCTGTCATCGTTGTCGTCGGGTTTTGGCGATGGCGAGATTGTGGATC
TTGAGCTACCGCCAAAGCGCCAGCAGCAGATGCTGTCCGTCCCTCCTATGCCATCCACTCCTCTGGCTGTCACACTCGCC
GGCGCCGGCCACTTCTCCTGGATGCGTGCTAGCAGATTTGTGCCAAACAGCCGTCGTGAGACGGTATACACAGAAGCCGG
CGAAGACCAGCCGGCCAGGTTCCGCTCCGTCACATCGTGGGTTCACCAGCAGACAGGTCGCGTACGCCGAGCACAGCAGC
GGAGCAACGCGAACAACAACCCAGCTGCGGGAGGACCGTTAGGTACCACAGGGGCCACAAATGTCCAATCTGGTCGGGCC
AACATGTCAGCGGAATCCGAGATGCCAGCGACACCCGGAATTGCTCGTCCTATGCCGGAGGAACAGCGGTTGACGATGAT
GGTAGACGACGGCGAGGAGCCGCGGCGGCCAGAAACAGTTCCAGGCATCCATATGAAACCGAGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62