GenePrediction:GLEAN_262 Details

Name: GLEAN_262
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:603766..604655 (+ strand)
Length: 890
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:603766..603968 (+ strand)
Length: 203
Type: CDS
Source: GLEAN
Position: GCSC_167:604022..604655 (+ strand)
Length: 634
>GLEAN_262 class=GenePrediction position=GCSC_167:603766..604655 (+ strand)
ATGCTTGTCATGGCATCGCCGAATCATCTTGTCATCGTCTGTGGCCACGGCATCTGGCTAGGCGGACCGCGTCACGGCCA
CGACGAGGCCGAATGGCTCATCGAAAGCTACAAGGCCGGCGAGACGCCTACTTTTGTCGAGCACATCCGCGCCGGGCTGC
AGGTCCTGGCCGACGATGAGCAGGCTGTCATTGCCTTTTCGGGGTAGGTCGCCAGCCGAGGGTCTCTGTCCGCACCTGTC
GTTAATTTGCTTTCAGCGGCCCCACGCGCAAGGAGACGCCGCTGTCAGAAGGCCGCAGTTATGCCAACCTGGCCGCGGCC
AACGGCTACTTTGGCCTGCTGCAGTCGGGTGAAGACGAGAGTGGTACCGTGGCATCTCAGCTCCACCCGCGGATCTTGGT
CGAGGAACAGGCACTCGACTCCTACTACAACATCCTCTTCAGTCTGGTGGCCTTTTGGCGCGCACACGCCGTCTGGCCCG
CCCGAATGACCATTGTCAGCCATGCGTTCAAGCAGTCCCGTCTCGTTGATGGACACTGCGGGCCCGATGCCATTGCCTTT
TTGCCGCGCACACGCATCGGCTTCGTCGGCATTAACCCGCCAAACCTGCCGGCTGAGTTTGGCGGCACGGCGCCTGCGGA
TGACAAGAAAGCTGTTATGCAGGGTGCCCACGACGTGTTGGATCATTGGGCCGTCGACCCGCACGGCGTCGGCTCTCTGC
TGGCGGGCAAACGTCGCGGCCGCAATCCCTGGGCCATCGACCAGCGGCTGTTTGCACACGAGGACGAGCGGCGGCGCAGC
GGCCTGCAGACGCGTTTCGTCGGCGGTGACATGGAGGCTTTGACAGAAGACGGGCTGCGGCCTTGGAACGAAGGACCAGC
CTCTGATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62