GenePrediction:GLEAN_2630 Details

Name: GLEAN_2630
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2267274..2269562 (+ strand)
Length: 2289
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2267274..2268681 (+ strand)
Length: 1408
Type: CDS
Source: GLEAN
Position: GCSC_140:2268742..2268745 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_140:2268992..2269562 (+ strand)
Length: 571
>GLEAN_2630 class=GenePrediction position=GCSC_140:2267274..2269562 (+ strand)
ATGCCTCTACGGATTGGTGGGCGGCAACTGCTGAGGGCCGATCCCTCCTGGCAGATCAGAAATGGCGCTGGTGTATCTCA
AATCGGGAGGAGGATGTTCAAGAAAGGCAGCCCTGCACAAAACATCGTGACTGCGGCCACGGGCAGATCGCTAGACAGGC
CACCCACGGTGGGACACGTGCTTTCATCGACGGCAGCAACTACTGAGCCGGCTCTAGAGGGGGAGACTTTCGAAGCACCA
CAAAAAACAAGACAGGCAGAATTGAAGCATGCTCGACCATTTTCAGACTTCCTCACGGACACCTTCCAGCGTCAGCATGA
CTACCTGCGAATCTCGCTGACGGAGCGGTGCAACCTGCGGTGTCTATACTGCATGCCGGAGGAGGGAGTGGAGCTGTCGC
CGGCGCGAAACCTGCTGACGACGCCGGAAGTGCTGCTACTCGCAGATGTGTTTGTGGGCCAGGGCGTGAAGAAGATCCGG
CTGACGGGCGGCGAGCCGACAGTGCGCCGCGACATCCTGCCTCTTATGCGACAGCTGGGCGATCTAAGGCGGCGCGGATT
GCGCGAGCTGTGTCTGACCACCAATGGGCTAGCACTGCACCGGAAGCTGGACGCCATGGTTGAGGCCGGGCTGACGGGCG
TCAACCTGAGCCTGGACACGCTGGACCCGTTCCAGTTCCGACTGATGACGCGGCGCGACGGACTGGTTGCGGTGCGGCGC
AGCATGGATCGGATCTTGGCGCTCAACGCTGCCGGCGCAGACGTGCGTCTAAAGATCAACTGTGTGGTGATGCGCGGGCT
CAACGACGGCGAGATGGTTGACTTTGTGGGCCTGACGCGCGACCACGACCTCGAGGTGCGCTTCATCGAGTACATGCCCT
TTGACGGCAATCGCTGGAGCACCGGCAAGATGGTCAGCTTCAACGAGATGCTGGAGCGCATTCGTAAGAGCTACCCGACC
CTGCAACGCACGACGCCAGACGCACATCATAACCGGCTCCAAGACACGAGCAAGACGTACGAGGTGCCTGGTTTTGCCGG
CCGCGTCGGCTTCATCACGAGCATGACCAGCAACTTTTGCGGCGGGTGCAACCGGCTGCGCATCACGAGCGATGGCAGCC
TCAAGGTGTGCCTGTTTGGCAATGCTGAGGTTTCTCTGAGGGACATTATACGGCAGACGAACGGCGGTGAACCCATAGAC
GAAACACGCCTGGAGGCGCTGACACGAGCTGCTCAGGAGGCAGCCTCATCAACGGGCGACCCTGACACGGATCTCCCGAT
CAGCCATGTACTGCCAAACGCATCGGCACTGCTCGATGTCATCGGCATGGCAGTGAAGCGGAAAAAAGAACGACATGCTG
GCATGGACGAGCTCAAGCACATGAAGAACCGGCCGATGATCTTGATAGGTGGGTAGCCCACCCTCCCGAGCCGGAGCTCG
TGTGGACACAGGATGCTGCACAATCTAGGAAGGTGGGTTGAACAGGAGGAAGCTAGCGGGGCGAAGAAGCGGTTCGCAGC
AGATGTGATAGCAGCGCTTGCTGACGTATATCCAGGCCGCATGCATCAACATCTACGACAGCAGGATGCCACCGGCCGCC
TTGTTACAAATTGGGCTGTCCGTCCCAACAAGCGCATACCGATTTCTCCGCAAGAACTTCTGGGGGCATCACGGCCCCGG
GCGTATTCTACGGGCGGAAATGGCGGCAAAGGCGACAGCTCACAGCCACTGCCACAAGCCCCACGGCTGACACACGTCTC
GGCGTCTGGCACGGCTCACATGGTGCCGGTGGGCGACAAGAAGGTGACTGCGCGAACGGCAGCGGCAGCGTGTACGGTGC
AGTTTTCCAATTCCGTAGCAGCGGCACTGGTACGGGCCAACGAGATGGCCAAGGGAGACGTGCTTGGGGTGGCTCGCGTG
GCCGGGATCATGGCAGCAAAGCGCACGTCGGAGCTGATTCCCCTGTGCCACCCGCTGATGCTGTCATACATCGGCGTCGA
CCTGGAGGTTTCGACGGCTGGCGAGGGGTTTGGTGAGGGGTCTGACGACAATGCCAAGGGTAGTTGTGGACACGTGAAGA
TTTGGGCAACAGTTCGGTGTGAGGGCAAGACCGGTGTGGAGATGGAGGCGCTGACGGCGGCGAGTGCGGCAGCGCTGACG
GTGTTTGACATGTGCAAGGCAGTGGACAAGGGTATGCGAATAGAGGGGCTGCGGGTGGTCCTCAAAGATGGAGGGAAGAG
TGGACGATGGGAAGAGAAGGGATGGAGACAGGTTGGTGGCAGCGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62