GenePrediction:GLEAN_2634 Details

Name: GLEAN_2634
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2293551..2296039 (+ strand)
Length: 2489
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2293551..2294890 (+ strand)
Length: 1340
Type: CDS
Source: GLEAN
Position: GCSC_140:2294962..2296039 (+ strand)
Length: 1078
>GLEAN_2634 class=GenePrediction position=GCSC_140:2293551..2296039 (+ strand)
ATGGCTGCAGCAATGACGACGACGCCAGGCTCGAGGTTGTCGCTGGACCGCCTGCCTGAGGACATTTTGTATCTGATCCT
AGCATATCTGGACACAGCGCGGGATAATGCTAGGCTGAGCGCGACCTCTCGACGGCTGCACCGCTTCATGCGCGTTCAGG
GCTGGCGCGCCTTTGCGCTGCGGTGCTTCCCGGGGGTGGTGACCGCCTCTGTGCTATTGGGCGGCAGCAGCCCTTCGGCT
CTACGCTGGGATCAGCTTTCGGACTCTCTGACGTGGCAGGCACGGGCCTGGGATCGTCGGTCCCTGTCGTTCCAAGCGCT
GCTACCACGCGAGGCAGTGCCGGCTAGGAGACCGCGTCGACAGGCATCTTTCCGGCCGCCGCTGGTGGTGCACTTCCAGG
CGGCCGGCGAGGGGACGCAGTCGAAGAGGCCGGGCATCGACGGCGAGGAGATGGTGCTATGGGGTGCGGGAGAGGACATT
GTGGCGCGGTACAGGCGACGAGGAAGATGGGAGGAAAGTGTTGGTGGCGACGAAAGGGACAACGAAGAAGACGACAATGC
AGACGATCCGACGGCAGTGGCGCGATGGCGTGTCTTTGACGGTAAGGCGGCGGGTTTCCGGCCTGGTTACGACGATGTGC
GCGGCCTCGCGGTTGTGCCGCATGCCATGGGCCGGCCGCATCGTCGGGGCGTGCTGGTCGGCCGGGACAACGGGCACCTG
GTGCTGCTATCGGCCGAGGACCGGTCTGACGGAACCGGCAGTCGGAGCTCTGGCTTTGGCTTTGGCCGGACGCTGGCGCA
ATTCTCTCCAGGCAATGACAGCAGCATTTTGCAGGATCGGATCTACTCGCTAGACGTGGCTTCAGCCGGCCGAGCCTTTG
GAGGTCTGGACAATCGGGGCGGCCTGGCGGCCGTCGCCACGACCTCGCACATTGTCTTCTACGGGCTGCCGAGTGACGAT
GGTGAATATGGAAGCAACGAGGACGACGACGGCAAACTGAAAGCGCCTCGACAGATTTTCCCGACCGCCACCTTTGCCAT
GGGTGACCGCGGCCTCGACATCTACCAGCGGCGACGGCCGTACAGTGTTCGGTGGATGGCAGCCGACGGTGTGGCGGCTG
TCGGCCTGGGCTACAACGCCGACCAGCTCTGCTTCCTGGCGGCCACGCCGACAGGCCTTGCGCTGACGGCCGTCGCCAAG
AGCCAGCCGTTCCAGCGCCGCTTCGGCCTCGATGACAAGACCCTGCTGCTGCCCAGCTCGCTGCAGCCGATCGAACCGTT
GTCTGTGGCCGGCGGCGGCGGTAATCTGCTGCTCAGTGCCTGGCGCGACGGGACATGCAGGTGGGTGTTTTGATCTCTTG
CTCTCTTCGGGATTTCCAGTCCAGTCCAAATTCAAACTGCTGACTAAGCAGACTTCTCGATATCCGGTCGCCGAGTCCAT
GGGATATGGCCTACCAGGACAACCTAGCGCCGTCGCAGTGTTTCCAGTCATTACTGGTATGGGGCAGTGACCGGTTCGTG
GCCGGTAGCCAGGAGTCAGCGGCGCTCAAGGTGTTTGACCTGCGGTGGCCTCGTCGCTACCACCACTCGGAAGCGCTGCC
ATGCGGTAGCCGGATGCCGTTCCCGGACCCGGAGCTGCAGCAACAACCACCGGCGGACGTGCAGACGGACTGGACAGTGC
CAGACCACAGCTACGGCTGCACAGCGCCGATTCCACGCTGCCGAGCACGTTGCGACCCCCTCACCGGCACCCTCTGCACG
TGGCACGCAGGCTCGCGTCGGCTGGCCGCCAGACCCAACTGCAGCGTCTATTTGCAGCGGTCGGCCGTCAGCCAGTACCC
CGACATTGGCGTCTGGTCGCTGGCGCGGGCCACCACGTCGACCGACGGCGACCTGGTACCATCCAACTTTTATGCCGGGC
TCAACAGCTGCGTCGTCGAGGCCGTGCTGGCAGACGGCGGTGGCGAGAGCATGATGCGTGGCCGACGACAACGATCTACG
GCCCATCTTCCGCTCGGCGACCCGCACTTTGCTTATCCTGACGTCCTCTGCCAGCGGCCACTCTCGCTCGTGCCAGCCCC
TCCACCCGAACTCGGCCCCGAAGCTGCTGCGGCTTGGCGCCGTCGTCAGGCTTTCCTTCAGCATCGCCACCACTTTTATC
GCATTGTCGACTTGCAGTGGCACCTGCACGAGATTGGCGATGGCCTTGCCGACCCTCATAACGACCTTCGTCCTCGTCGT
CTCGCTATGATGCGCCTTAGCAGGCCGTCGGGCCATCGGCGCATGCCACCCCCTCCGTCTGCTTCGGCTGCTGAGACCGA
CTGCGACAAGCCTGGAGCCGACCTGCTGGACCCCCATCGCGTCCGGCCCCAGCTTCTCTCTGGTCGACAGCTCGATGTCG
ACCCTGTCCTTCGCGCGCAGCACCGCCTCGACAACAGCCTGCAGGACCTGGCCGACTTTGCCGACTTCTACACGGCCAGC
GACAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62