GenePrediction:GLEAN_2636 Details

Name: GLEAN_2636
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2306412..2310075 (+ strand)
Length: 3664
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2306412..2307111 (+ strand)
Length: 700
Type: CDS
Source: GLEAN
Position: GCSC_140:2307178..2307225 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_140:2307299..2310075 (+ strand)
Length: 2777
>GLEAN_2636 class=GenePrediction position=GCSC_140:2306412..2310075 (+ strand)
ATGAATGAGGAGCTTCAGAGCAACGTAGTTGTATCAGAAGGGGACGGTTTTCCGGATCCCGATGACAACTCCAGTGCCGG
TGGCTTAGAAAGGGCCACGCAGCTCGGCTCCACAAACGGAGACAGTATTGAACAACACTACGGCGAAAACGACGACGAAG
CTGGAGAAGACTACGATGGCGCAGAAGATGATGAAAGCGGCTTTGGCTCGGGCTCGGGCTCCGACCTAGGGCGAGACGAT
GACGAAGATGACGGCTACGACTCTGAGAGCGCAGGCGACGACGAAGACGAGCACCTGGAAGGCCCTGGCTTGGCGAAGCG
CGGCCCGAGAATCAAGAACGAGGACGGTGATGAGGATGAGGACGAAGAAGAAGACGAAGAAGAAGAAGAAGACGACGAGG
ATGCCGAACTGGACGCCGACGCCGATATCATCGAGGATGCAGAAGGTGTCGGCGCTGTCAAGATTCGCCCCGGCGAGACA
GACGACGAAGACGATAGCGTAATCAGCGCCGGGGACACCCAGTCGAGTGACGAGGACTGGGATGAGAATGCGGCAATTAT
AGAGGAGGACGAGGAGGAAGGAGGTGGTGTGGAAGAGGACGGAGCATTTGGAACGTGTGTGTTCTGCAATCAAGACGAGG
AGCACGGACCGAACGAAGGCGTCGAGGCTTTCCTTTCATGCTCTCACTGCGTGGGAAGTGGTAAGAAAGCCGATCCCAAA
TTGATGTTGCCGTTCTATGATCCTCCAGACCTTGCTAACCTTGCAGCCCACGAAGAATGCGCCCACGAGCATGGATTTTC
CACGCAGGACGGGGGTAAGTCATTTATAGCTTTTTCGTCCGCCATGTGGCGTGTTATGAGGATATCCGATGGCTAACTTC
GTGATAGAGACGTGGAGATGCCCGGACTGCGTCGCAGAAACCGAGCGCGGGTCGGTTGTGGAGGACATCATGGACATCGA
TGGAGACGGAGGGGCCAACGGTGTTCACGCTGACATGCCGGCCTTGGCAACCCCAAAGCTGTCACCGGCACCGCAAGGTA
CAAGCGTCAGTGTGGAGTCTCGTCCGGAGGATCATTCAAGCAGTGTTCCTCGATCTCTGCGTAAACGAAGATCATCTCCT
ATTGAGGTTGATGAGGGCGGCATGTTATTGCGCAAGCGCAGAAAGAACATAGCCGAGGACCTGAGCGTTGATGACAACGG
AAGACCGTTGGACTCGGCTACACCATCTTCTGCTAGGTCGCTGCGGGTAAAGCCGACATCATCCTTGGTGTCGATTGAGA
AAAGGACAAGGACCAGCCTCATCCTCAAGATACGGGTGAATGGAGCAGAGCTCCGCAAAATCTTCACAAAGCGTCGGAAG
TACACAAGAAAGGGTCAGAACAAGGCCGAGACGACTCCCAGGCCGGGCAGTGCGCGGAGTGCGGTGCACGTTGGCCTGGT
TGCTGGCGCACCACCTATAATTACCAGCACCCTCATACAACCGTTCTATTCCTTCTTTGACAAGGAGACAGAGGAGCTCA
AAGGAAAGCCGTACGGGGGAATACTCACAGAGGCCGAGGCTGAGACAACACGGACGTTTCCAGCTGCGGAAGACAGAAGA
AAATTTGGCGAGGCCAAGCAACAAGCCGAGGAAGAACGACAAGTCCGGCTATTGGTAACGCAAGCGGAAGCGGAGGCGCC
CAAGAAGAAGCCCAAGAAAGCAGTGGACCCGGCCAGCCAAATTGAGTGCATCGAGTTTGGCGGCTGGGAAATTGGCACGT
GGTATGCGGCTCCATACCCAGAGGAGTACAGCAGGAACCAGGTCCTCTATATCTGCGAGTTCTGCCTCAAGTACATGAAC
TCGGACTATGTTGCGTGGCGGCACAAGCTCAAATGTCCAGCGAAGCATCCGCCAGGAGACGAAATCTACCGGCACAAGTC
CGTCTCGGTCTTCGAGGTGGACGGCCGCAAGAACCCGGTCTACTGCCAGAACCTGTGCCTCTTGGCGAAGCTATTCCTTG
GCTCCAAGACGCTGTACTACGACGTGGAGCCGTTCCTCTTTTACGTGCTGTGCGAATACGACGAACTTGGGTACCATTTT
GTGGGGTATTTCTCGAAAGAGAAGCGTGCCAGCAGCCAGAACAACGTCAGCTGTATTCTCACGCTGCCAATCCACCAGCG
CAAAGGGTACGGAAATCTTCTTATCGACTTCTCTTATCTTCTGACGCGGGCCGAGAAAAAGACGGGGTCTCCGGAGAAGC
CCCTTTCTGACATGGGTCTGGTGTCCTACCGAAACTATTGGAGACTGGTGATGTGTCGCTATCTCCTTGGGGCCATGACG
GAGAGCAAGACGGACAAGCTGGGACTGTCCATCAAACGGATCTCCGACGAGACGGGAATGACGGCCGACGACGTCATTTC
GGCGCTGGAAGGCCTTCGCTGTCTCGTGCGCGACCCACAAACGGGTTTATACGCATTTCGAGTGGATCTGCCCTACTGCC
GCGAATACGTCGCCAAATGGGAGGCAAAGAACTATGTGACGCTGAACCCCGACGCGCTGACGTGGACGCCATACGTGATG
GGCCGTGGTAACGCGACAAACTTCGAGCTGGGACCGGCCCTGACTGCCATCGCACCGCGAGATGAGGATGACGAGCCGAA
GTCGGCCAACGAGTTTATCGCAAGGCTGGTCAATGGCATGGACAGATCGGCCGAAGTGAAACGTGCTGGTGGAGATGCTG
AAGAGGAAACAAAACCGTTGGACGAGATGGAGCATGGCCAAGCGACGACTGTCCTGGAATCCACGGAGCCCAACGAAAAC
GGACCCGGAGCAGTTCTTGGAAGCAACGGATGCCCTCAGCATGAGAGCACAGAGGATCAATGTGCCAGTATGGCTATCCG
AAGCATCGAACCATCCCAGTCTGTTGGTGGCGACGGTTCTCCATCCGACGGAACACGAGAGGGGAAATCTTGCTCCATGG
ACAGCAAGGATCCACTGGATGCAGAGAGTTATAGTGCGGGCAAGGTACGGACATCGATGTCTGCAGACGACTGGACAGCA
CCATATGCAGACGTGCCGGCCACTCGGTTTGTAGTGTTCCCGCCTATATCGGCACGCCGGTTCAACTACGCGCGGACTAC
GATTGGGAGGCCATCTGCACCTCGGATCAGCAACAACGGGGTGAGAGGAAGAAGCCGGTACGGATCGAACAGCATCCGGC
GACTGACGGTGTCCCGACCGAAAACGAACTCGACGCGGAAGAAGTCGGGAGGCACCGGTCGAGGACCTGGCCGTTGGCCC
AAGGGGACGAAGAAAAGCGATTATGGAAACGCCGACAGCGGCCCTGGTCTTCCGCCAGCGTGGATTGCCGAGAGACAGGC
GCGGCAGACGACGTCGACAACGGCTGAGCCTGCGTCACTGAATGGCAAAGAGCCCATGGCCGAAGGGGATGCTGTGGCCG
TTGCGACTTTGATGCTGCCGACAGTAACAAAGGAGGAGGATATGGACGAGCCGCCCGCAGAGGACACCGTGCAAGTCCAC
ACGCCTCCAGCCAAGATGCGGAACGGGCTGAGTGCTCCGAGCGTATCGTCGAAGAGCAGGTCGTCACCGCGGCTAGGCAA
AGGCAAGGGGCTGTTGCAGGAGAGCGAGGACACGGTGATGGTAGGTGTCGAAGAGGACGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62