GenePrediction:GLEAN_2637 Details

Name: GLEAN_2637
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2311165..2313062 (+ strand)
Length: 1898
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2311165..2311237 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_140:2311309..2311378 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_140:2311494..2311714 (+ strand)
Length: 221
Type: CDS
Source: GLEAN
Position: GCSC_140:2311786..2312428 (+ strand)
Length: 643
Type: CDS
Source: GLEAN
Position: GCSC_140:2312513..2313062 (+ strand)
Length: 550
>GLEAN_2637 class=GenePrediction position=GCSC_140:2311165..2313062 (+ strand)
ATGTCGAAGGTTATGAGAAGCGTGAAGAATGTCACAAAAGGCTATTCTAGCTCGCAGGTCAAAGTGCGAGAAGGTCCGTC
ATGGCCTGCCTCCGTTTGTCGCATCGCCCTGAAGCTGCTTGCTAACTGGCTTCTTGTCGTGCAGCTACTAGCAATGACCC
ATGGGGCCCTACAGGTACCCAGATGAGCGAGATCGCTCAGCTCACCTTCAGCTCGTATGCTTCCCTTCCCCTTGAGCGAT
GGACTTCTCCAGCACTGCCTGTAGCGGCCTGGACCTCTGGCGACCCAACTATAGTGTCATCATGCTCATACCCTTTGTTT
TGATGACAGGTCTGTCGACTTTAGCGATATCATGGACATTATCGATAAGCGGCTGAACGACAAGGGCAAGAACTGGCGAC
ACGTCCTCAAGGCCCTGAAGGTGCTCGACTATTGCCTGCACGAGGGCTCCGAGATGGTTGTGTCCTGGTCCAAGCACAAC
CTCTACATCATCCGCACCCTGCGCGAGTTCATATACGTCGACGAGGAGGGACGCGATGTTGGCCAGAATGGTTCGTACCA
GCAGCAGAACGTGTCCTTTCCGCCGTGCTGCATCCGATAGCTAATATGATTCGATGGTTAGTTCGCATCGCCGCCAAGGA
ACTCACGGCCCTCATCCAAGACGACGAGCGGCTGAGAGCAGAGCGCAGCGATCGCAGGGTTTGGAAGTCCCGTGTGACCG
GGCTCGATGAATACGGCCCGCAGCACAACGATCCTCCGCCTCACCGGCGTCACCGCGAACGGAGGCAGAACGATGATGAG
GATGACACCGAGTACAAACTGGCGATCGAAGCTAGCAAGCAGCAGGAGGAGGAAGACCGCAGAAAGCGCGAGAGCCATTC
TGCCGACGGCGGCGGCGACGATGACCTGGCCAAGGCAATCAAACTGAGCAAGGAAGAGGAAGACCGTCGACGCCGTGAGA
TTGAAGCCGCCAATAACAGTAACAACAATGCCGACCTCCTGTTCGATCCAGAACCAGCGCAGCCGGCTGCGCAGCCGCAA
TTCACCGGCTTCAACCAAGGCTATCAGCAGGGCAGTGCTGTCGACTTTTTTGCGAACCCCATCGACCAGAACCAGATGCA
AATGCAGCCGACCGGCTATAACATGTATGCCCAGTACGCGCAGCCAACTGGTGTCCAGAATGGCTATGGCGCAAACGGTT
TTGTCGCACAGCCGACTGGCTTCGACCCGTACAACCAGGCGCTTCAGCTGCAGCAGCAGCAGACGTCCTTTTCGAACAAC
CCCTATGGCCAGCAGCAGCAGCAGCAGCAGCCACAGCAGCCGCAGGAGCCCACACTTCATCCTGGCAGCAACAACCCGTG
GGCTACCTCGAACAACACTGCTGCGCAGCCGCTGCAGCCGCTGCCAACGGGCTCGAACAACCCCTTTGCCGCCAACCCGA
CGCCAGCCCGAGCACAGCCTTTCCGGTCCTTCTCGCCTCTGTCCAGCCTGCCAGAGCAAAAGTCGCTCTCGCAATTCCAG
CAGCAGCCCCAGCAACAGCCCCAGCAGCAGTCATACGCGCAGCCGCCGGCACATCCGCAGAGGGAACTTACCGAGCACGA
GGCAAGGCTCAACGCGCTTCTTGCCACCGGCGAGGGCTTGGACACGTTTGGCAACACGGGCCAGCTCCGTATTCCCGCCC
AGCACACGGCACCAGGGACGTTTGTCAACAGTGCTGGTGCCGGTCTCAGCCGCATGACGGCAGACGCCACCGGCACCAAC
CCGTTCCTGCGAGGACAGTACACGGGCATACCGACAGTATCGTATGGCAGCGGCATGTCCGGCAATCCATACGGGATACA
GCCACAGCAGCATCAACAGCAGCAGGTGCCCCCCCAGGGTGATCTCATCCAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62