GenePrediction:GLEAN_2638 Details

Name: GLEAN_2638
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2314528..2321331 (+ strand)
Length: 6804
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2314528..2314627 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_140:2314807..2314955 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_140:2315048..2318770 (+ strand)
Length: 3723
Type: CDS
Source: GLEAN
Position: GCSC_140:2319105..2319308 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_140:2319375..2321156 (+ strand)
Length: 1782
Type: CDS
Source: GLEAN
Position: GCSC_140:2321224..2321331 (+ strand)
Length: 108
>GLEAN_2638 class=GenePrediction position=GCSC_140:2314528..2321331 (+ strand)
ATGTCGTTTGGGTCTGGTGGTTTTGGTGGCTTCGGCCAGCAGAACCAGTCGTCAGGCTTTGGATTTGGAGCAAATGCGGC
AAACACAAACACAACCCAAGGTATGTACCTGCTTTACTATGTCGTTCGTCTGCCAACAACCACTTCATACGAATTGTCAC
GTCACCATGTGCTTTCCTCTTCTGCCTCACACCACGTGCCCGAACCATCGACTCGTCTGTGCGCGGGCCATTCTCCCTGA
ACACGTCAGGACTAACCGGACCTGTCTCTTTGGCATCAGGTTTTGGATCCGGTACATCTGGCTTTGGAAGCAACGCCAAC
ACTGGTGCTGGCCTATTTGGCAATACTGCAAGCACTGGTTTCGGTGCCAATCCCGGTACGGCCTCGGAATACGCTCTCCT
AGACTCTATCGCATCCAGCCATCTTGTAGTCACTTGTTATACCAAGCGTCCATATTTTGCCTCTCGTTTTAGCACTCGTT
GTTTTCCTTTGTGGTCTAGAAACTAACTCATTTTATACAGGTGGTTTTGGCTCAACCGGTACTGGCGGCTTCGGCGCGAA
GCCTGCATTTGGTGCGACGACATCAGCCGGCGGTGGCCTTTTTGGAGCTACGACAGCCACGGCTGGCTCCTCTGGATTTG
GTGGTGGCGGCGGGTTTTGGATCGACGACAACCACCTCAACTACGCCTTTTGGAGGCGGCGGCGCCTCGTTGTTCGGCGC
GAGCAAACCGGCGTTTGGCTCTACAGCGCCCACTGGAGGGCTCTTTGGCAGCACAGCGACCCCGGCAACGACTGGGTTCG
GCAGCACGGGTGGCGGGTTTGGTGCTGCAGCAAATCCTGGCATCGGCACCAATGTCGGCGACCCTCCTGGCACCGCAGCC
GTCGCGTTTCAGCCGTATGTTGAGAAGGAGAACAGCAGCAACCAGCAGAACAGCTTCCAAAGCGTCCTGTTCATGGACGC
CTACAAGAAGTGGTCGATTGAAGAACTTCGTCTGGTAGATTACAACCAAGGACGTCGTTACGGCAACTCGACTGGCACTG
GTGCATTTGGTGTCAGCTCGAACTTTGGTGGTTTTGGCTCCAACAACAATACCAATACCACCACCACTACAAACACCGCC
GGCGGCTTGTTCGGCAGCGGCACCACCACGACCGGCTTCGGCAGCCAGCCTGCGGCTACGACCGGGGGCTTCGGTACAAA
CACCTCGACGAGTGGTGGCCTTTTCGGCGCCAAGCCCGCCGCGACTGGTGGTCTGTTTGGTAATACTACGGCCCAGCCGG
CACAATCAGGTGGCTTGTTTGGCTCTGGTGGTGGTAGTGGTGGCTTTGGGTCAGGCACTACTAGCGGTTTTGGTTCTGCC
AACACCACTGCGGGCACTGGGCTCTTCGGCAACGCTGCGGCGCAACCTAAGCCGGCCACTGGATTCGGTTTTGGATCCAA
TACTCAGACCACAGGTGCTTTCGGGAACACTGGGACTACCAATACTTTTGGCACCGCAAATACTGGAGCCACCGCAAACA
CCGGCGGCCTCTTTGGCTCCACGCCTACCAACACAGCCACGACCGGCGGTGGACTCTTTGGGTCTGCAGCCCCCCCAGCA
ACCAGTGCAGGCGGATTCGGCACCGGTGCGGGCGGCGGATTTGGCGTGCAGAACACTCAGGCGGGTGGATTGTTCGGTCA
GGCCAAGCCTGCTACCAGCGGCCTGTTTGGCACGGCAACAGCCAACACAGCTGCCCCGGGCGCTTCTGGTGGCATGTTCG
GATCAACAGCCACGTCCTCGCCGTTTGGCGCCAACAACAACACTCAGTCGACGTTCTTGCAGAAGCCAGCCGCTACGACA
GGTGGAGGTTTGTTCGGTAATGCCACAGCTCAGCCAGCAGGGGGCGGTGGGCTCTTTGGAAACGCGGGCCAAAACGCTCA
GCCTCAGCAGCAAGCCCAGCCGGGCTCGCTTTTCGGTGGTAGTATGAACCAGACCCAACCGAAGCAGTCGCTATTTGGCT
CCCCGGCTCCGGCTGCGACCGGCTCCCTTTTCGGCGGTCAGATGAACAACCAGCAGCAAACCGGCAACGCGTTTGGCCAA
AGTACTGCAGTACAGCAGCAGGGTGGCGGCTTGGGCGGCTCGCTCTTCGGGAACTCGACCCAAGGTCTGGGTGGCTTGGG
TGCGACACAGGGCCTGACCACGAGCATTTCTGACGCTGGCGCTTATGGGGCCCCTTCTCTGTTCCAAAATCTGGCTACAG
CTGAAGTGCACAACCCCGGGCCTCTTGCCACTCCGCTGTCGTTGAACAAGAGCAAGACCTCCCGGCGGAGCTCCATTCTG
CCGTTGTACAAGATGAATCCCGGCTCGGCGTCGAAGTTTGCCACTCCCCAGAAGCGTGGCTATGGATTCTCCTACAGCAC
GCTCGGCACCCCCAACAGCGCTTCCAGCATGAGCAGCACGCCTGGTGCCTTCAGCCAGAGCTTGCTTGTGGGCGGCGCCG
GCCGTGCCCTGTCTCAAAGCATCTCGTCGAGCAGCCTTCGGCGTACTCTTAACGCGGACGACAGCATCCTTCTTCCGGGT
GCTTTCTCGACCAGCTCTGGCTCACGTTTCTACGGAAGTGTCGGTAGCAGCAAAAAGCTGGTTATCAACCGCGACATGCG
CTCTGATCTTTTCTCCACGCCCACCAAGGTCAAAGAACCAAGCAACGATTCGTCGGACAGTCTGGCGCCCGGAAGTGCAC
GGAAGCTCCAGAAGCGAGTCAGCTTCGATACCACGGTTGCTAAGGATAACGGTGGCGAGAACGGACGTGCCAATGGCAGC
GCCAATGGCAACAGTGCAGACTTGGGCTATCTTCGGCCGCAAGGCCGTTCTGTCAACAACGGCGCTGCGACGGCGACATC
GTCGGAGCCTGAGATGACCCAAATCTCTGGAAAGGAACTTGCCGTTGTGCACGAAGAGGAATATTCCCCGGCCAACCGCT
GCATACCCGACGACTACACGATCAACAGCAAAGACCTGGGGGAGTACTGGATGTCGCCCTCCAAGGAAGAGATTGACCGC
ATGAACCGGATCCAGCGCCAGCAAGTTGCCAACTTCACTGTTGGGAGAGTCAACGTTGGGCAGGTTCGGTTCCGCGTCCC
TGTCGATCTTACCAAAATCAGCCTCGACTCTATCCCCGGCGGCATCGTAACGCTGATTATCCGCTCTGCCACGGTTTATC
CCGACATAAACACAAAGCCTCCTGTCGGCCAGGGGCTGAACGTGCCCGCTGAGATTATGCTTCTGCACACGTGTCCTCGG
AGCGGACCTGACGTTTCTGCTGCTAAGATGAAGAAGCACATTATGCGTCTGAGGAGCATTCCTGACACTTCGTTTGTCGA
CTATGACGAAAAGACAGCAGCATGGACGTTCACGGTCGAACACTTTACCACCTACGGCTTTGATGAGGATGAAGATGACG
AAACAGACGCCGAGACGACGATTGTATCAGCAGCAGCTGCTGGTGCTAACGGCTCGGCCACGATTGCAAGCCCGGCTTCG
GGCGTCCGGACGGCAGGCAGTGACGACGACTCGTCAGACGCCCGTCGGCGCAAGCGACCCTTCGTGCCTGGTGCGTTTAA
TGAACAAACCGAGATGTCGGATGACGAAGATAACCGGACTGAGGAGATGTCTTTTTTATCTAGTCGCTCTGCGGAGATGA
GTTCTCTTGCTGTTGTGCCCGCTGCATCGACGACGCACGACCTTGATATGGAACCGACACAGGATGGACTGATGGAGACC
GAGCACGAGGCGTCTCTTTCTCGTCAGCCCTATTCTGCCGCAGAGCACGACAACGACAGCCTCCAAGATTCGCCACCCGC
CCCGGGCCTAGTTCCTGTGATCCCGGAGACGCCTGCAGGCGTTGTGCGGGCTCGCATGCGAGCGATCAAGGAATCGAGCA
CGCCGATCAAGCTCCAAGTGGCCGACGGCGACAACTGGATGGAAATGCTGCAGAAGACTGTCAGCCCTCAGAAACGTGAC
CGGGCGGCCCTGAAAGCTCTCAGCGGGCTGAACGTCGACAACAAGCCGGACTTTCGCGAGAGCAAAGTCGGCTTCGACAA
CAAGGTTGGCAGAGCGTCTATCAGTGCGCGGAGTCGGCTGGTCAACGACAACCGCGGGTTTGCAACGAGCATCGATCTCA
TGAACTCGCTTTTCGAAAAGGCCAAGGCACCGCCTGCTAAAGCTCCACCAAAGGCCATCACGACAGCCAAGGGCTTCATG
AAGGTTGGTGATGCCCTCCTTGCCTAGTCTTGGGATTTCCCACCCTTCTTATCACATTTTACACCCAGCATTTTGTTTTA
CTCCCCCTTCAGCATCTACTCTTATCCCCCCTGCATTTAATCCCGCTGGCATAATCTGATGTACGAACTTGGGTCTGGCG
AATGCCATACTTTGCTCATAGTGTCATTTCTTTGCTTGTATTCTGTACCTGATATGAACAAGTCTGCCATGTTCCACCCC
TAGTTTTGTCACAACAATATAAACCAAAACCAACCATCAAAAGAGGATTCGCGGCACATGAGACAAATGCTAAAAACTGT
GGTTAATCAATTCTTAGTGGCCGTACAACAGACAAAACAGAGCAGCAGACGAGGACGAGGCCAACATGGAGCCAACAGAG
CGAGCTTTCCACGAGTCAATGAAACCGGCCTGGTCTGCTGACGGCTCCTGCATCGTTATCGACGAGCAAGGCAACGGCTC
CTTCGAACCAACGCTGAAGCGACTTCGCGTGTTTGATTCTCTCGACCCTACTTTAGCATTCGTACGTTTGCTGCGCTTAT
ACTAGAAGAAAAACAAGATATTGAACCAATGCTAACTGCCATCGCAGGATCCCCTTGAAGGCATTGCAGAGCACAAGGAA
GCAATCGACATTGAGCTCGTTAATGGAGTGCCCTCTGTGTCGACTCGACGGGTTCCTCCCATCAAGACATTCGCCGGGTT
CTGCGAGCAAGCAAATCGTCGCAGAGCAGCCAATGCCGGGCTGCTAGCAAAGCAGCAGGGATCATACGAACAGTCTGTGT
GGGAGCTGGCCAGCGTCCTTTTCGACCCCGTGGATGGCCTACTGGATACGGCCGACGAGACCCGTGCTCGCAAGGAGAAT
CTCAGCCGGTTTTGGGCCCAGCTTGTGCAGGACGCAACGACGAAGTCACTCGAACAGGCGCAGTCACTGGAAGAGAAGGC
GGTGGTTTACCTGGCCGGTCGCAAAGTGCCGGAGGCCTGCCGAGCTCTTGTCGACAGCAAGAATTTCAAGGCGGCAACAC
TGACATCTCTCATCGGGACCAGCAACGCGTTCAGGAAGGACATGCGGGAGCAGATGGAAGACTGGCAGCAGGGCGACGTT
CTGGCCGAGTTCAGCGTACCGATCCGGTCTCTTTATTCGCTTCTGGCCGGGAATGTGTCCGTATGTGAAGGGAAGAAGGG
AGGCGGTGTCGAGAACCGAGTGAACTCTGTGGTACTGTCGGAGTGGTTTGGCCTGGATTGGAAGCAGGCCTTTGGACTGC
GTCTTTGGTACGGCATCGCTGCCGGGGAAGGCATCGAGACAGCGGTGGCCAAGTTTGTGGAAGACCTGGAGCAAGGACGC
GTTCCCCAGCCTCGGCCGTGGTACGCCAACCAACGAGATGTGCCGGTGACATGGGCAGTGCCAGTGAGTGCTGTTCGGGA
AGATCTGCTGTTCGGCCTCTTGAAAGTAGCTGCCGGACACGCCCGTCTCGAGGATGTCTTGGAGCCAGAAAGCTCGCAGG
CTTCTCCGCTTCGATTTCGCCTGTGCTGGCAGATCAACCAGGCGCTCTCGGCAGCAGGCAACATTGCAGACTCGGCCAAG
CTGTCTCCAGCCAAGGCGGACATGCTCACGAGCCAGTATGCTGCAGAGGTGGTGTACAGCGACAGCCGCGAAGTGGGAGA
CAACGGGTGGATCCATGCAGTCTGGGTGCTTATGCACCTGTCGGACCCGACGTCACGCGTGCAGGCAATCCAAGACGTGC
TCGGCCGCCATGCCGGACGGCTGTTCGAGGGCAATCGGAGTGGCCAGCCGGCGGGGACGAGCCTGTACGAGCGCCTAGTG
GACGATCTCAAGATGCCGGCGGCCTGGGTATGGCAAGCATCGGCCCTTTACTGGCGCTACGAGCAGAAGCAGCCTGCACT
GGAGGCCGAGTGTCTGCTGCATGCACTGGCGTTTGCGGATGCGCACAGCATCTTCGTCAAGGAGCTGGCGCCCAAAGCGA
TTGTCGAGCGCAACTATGGAGAGATTGCGCAGATTCTCAGCAAGCTGCAACCGCACCGCCACCAGATCTCGGGCTGGGCG
CTGGGCGGTGAGGTCTACAGCCGGTTCCTGGACCTGCTGACGCTGCAGCGCAACGGAACGCTCGAAGACCGCGACAACGA
AAGCAGCAGCAACAGCACAACACGTCGGACCCGAGGCCAGCAGCAACAGGCCCGAGCCGGCGCAGAACAGGCGTCGGTGC
AGCTGTCAGGGGCCGTCGAGGCTCTCGTGTCCAGCCTGCCGGCAATGTACGAAAATGCAGGCGATGACAGGCCGACAGAG
GTAGCAGCCATTACAGAAATGGCGGATGTGGTCGCAAAGGAGACAATGGCGCTCGCCAGCAAAGGACGGGTACGTGATAT
CGCCCTCGTTTCTTCTGTGCCTTATTGATGACTAACCAATGATATTTCTGCTGCAGATGGATTTGAGCAAGATCTCCCGT
CTGCCCTTGACGGAAGACCGGCGGCTGCGCTACTCAAACGACCTGGCTTTTGCCTATTATCGAGAGGTGATGGCTGCACA
ATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62