GenePrediction:GLEAN_2640 Details

Name: GLEAN_2640
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2326255..2326784 (+ strand)
Length: 530
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2326255..2326376 (+ strand)
Length: 122
Type: CDS
Source: GLEAN
Position: GCSC_140:2326613..2326784 (+ strand)
Length: 172
>GLEAN_2640 class=GenePrediction position=GCSC_140:2326255..2326784 (+ strand)
ATGTTAGCACTGATAGGTGTTTTCGAGACTGAAGGTGTCGGCGACGCCGAATCCAAGACACGTTTCACCGAGCCGTCTGT
CATCGGTGTCGAAGTCAGCAGGGCCATCCATCTGCGCACGAGGTGCGCCATCCGCCCTGGGGCGCTGGGTTTGATTCTTG
TTGGTGGGCTGTACTTTTTCCACCAGGGAAAGGACGGATGCTACTTTTGGTTTGGCGGACAATACGGTCGAAAAAAGCTT
TTGCTCCTTACTTGCGCTCGCAAGCCGTAGAGGCGCTAGAGCGATGCGCTGACACCATTGGCCGCCGGATGATTAATTGC
GGGGTTGGCCGTGGGACATACTGTTCACATGTAAAAAGGCAGAGAGGCCAGGTACAAGATACGGAGCAGACTGCCGTCAA
CGAGAGCAACGGTCGTAAGATGCCGCAGACGAGACAGACCGGCTCACCGTCGGCGAAGGCGAGGCAAGATAAGGAGGACC
GCGGGGCACGGAGGGCTGGCGGACGACGCCGAGGTGGCATGGCTAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62