GenePrediction:GLEAN_2641 Details

Name: GLEAN_2641
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2327342..2329060 (+ strand)
Length: 1719
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2327342..2327506 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_140:2327584..2328007 (+ strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_140:2328083..2328312 (+ strand)
Length: 230
Type: CDS
Source: GLEAN
Position: GCSC_140:2328368..2329060 (+ strand)
Length: 693
>GLEAN_2641 class=GenePrediction position=GCSC_140:2327342..2329060 (+ strand)
ATGGGCATGCTTGACTTTAGGAAACGGAAGGAGGAAGAGGAGACGGCGCCCGTGTCGATCTCCGAAATGGATGCGGCCGT
TGTTGCTCCGGCGAGCGAGAAGATGGTCACACTCTCGGTTGCTGCCTGTGGTGCCGGTCTCTTCTCGGACGGCTATGTCA
ACAACGTGAGTCTGGTGTGGTTCCTGTGATGTTTGCGCTTCTCGTGCAGCTTGCCCTTCCAGTCGCTCACTCTCCTGTCC
AGGTGATCGGCTCCGTCACCACCGTCCTCAGCTTGCGCTATGGCAACACCTGGAAGCATTCGCACGCCAAGAGCGTCGTC
AGTGCCATCGCTTTTGCCGGCACCGTCGTTGGACAGCTCTTCTTTGGCGTCCTTGCCGATCGCTGGTCGCGCACCAACTC
TCTGCTGGTGTCCACTGTCATCCTGTTCATCTTCACTGCCCTGGCCGCCGGCTCGTACTTTCATGGCTCTGTCGTCGGCA
TGTTCAACATCCTGACCGCATGGCGCTTCTTTGTCGGCATCGGCATCGGCGGCGAGTATCCTGCCGGCAGCGTGGGCTGT
GCCGAGGCTACGGGCGAGATCAAGAGCGGCTGGCGCCATTTCATATTCATCATCTTCACCAACAGCCTGATCGACGTCGG
CTTTGTCGCCGGTGCCTTTGTGCCTTGTGCGTATTTCCTTGGCCACCTCTTTCCCTTTTGGGCCTGGGACTATGACGGAA
GCTGACTCAGCACACTCTCAGACGTCGTTGCTGCCGCCTGTCACAACGAGCATCTCGACACTCAATGGCGCACGATGCTT
GGAATCGGCTGCGTTTTCCCCTTCCTCCTCTTTTTCATGCGGATTTTTGCCAAGGAGCCGGAGGAGTTTACCCGCAACTC
CATGCGCAACGTCCGCACTCCATATTGGCTGGTCTTCCGCTTCTACGGCTTCCGTCTACTGATTGTCAGCCTCATCTGGT
TCATCTATGATGTACGTTTCTGGCACCCCGGTTTCCTTCTCATCCATGTTTCTGACACACGCCTAGTTCCTCACATACGC
CTTCGGTATCTACTCGTCGGCCATCCTGTCCAACATCTTCGACTCCGATGCTCCTCTGACGACCGTCTTTGGCTGGAATG
TCGTGATCAACCTGTTCTACTTGCCAGGCTCTATTCTGGGCGCCAAGGCGAGCGATGTTCTCGGCCCTCGCTGGTGCCTC
ATAATCGGTGTCTTTCTGCAGGCCATTATCGGCTTCGCTATGGCCGGTGACTACAAGAACCTGTCGCAGCCGCACATGGT
TGGCGCCTTTGCCACCGTTTACGGCATCTTCCTTTCGCTGGGCGAGTTTGGCCCCGGAAACAACATCGGCCTGCTGGCCG
CCAAGACTTCTGCTACCGGCATCCGTGGTCAGTACTACGGCATCGCCGCCGCCTTCGGCAAGATCGGTGCCTTTGTCGGC
ACCTACGTCTACCCCTACATCGAGAAGGCTGGCGGCAGCGATACCAACGCCTCTGCCCAGTACCCTTTCTATGTCAGCTC
GAGCCTGTGCATCCTGTCCGCCATTCTTGCTCTTCTGTTTCTGCCCAACGTCGGCCAGGACACCATCGCCCTGGAGGATA
TTCGTTTCCGTGAATACCTCGAGAAGAACGGCTGGGACACTCGCCAACTGGGTATGCGCATGGGTGAGAGCATCGATGTG
ATCGAGAATGCCGAGGGCGTGCCGGATTCCAAAGCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62