GenePrediction:GLEAN_2643 Details

Name: GLEAN_2643
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2336743..2337599 (+ strand)
Length: 857
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2336743..2336961 (+ strand)
Length: 219
Type: CDS
Source: GLEAN
Position: GCSC_140:2337339..2337599 (+ strand)
Length: 261
>GLEAN_2643 class=GenePrediction position=GCSC_140:2336743..2337599 (+ strand)
ATGGCGCGGCCCTCCTCGGCGGCCACGTGCAGCGAGTTGGACGCCGTCAGCGCCTTTTGCATGCGGATGCGCATGTTCAG
CAGCGCGTCAAACGTGCGGCGCTGCTGGCGCACGGCAAAGCCCTTGTCGGCGTCCGCCTTGGCCGACTGCGATATCGGTG
CCAGCATGTGTTGCCGCTCCTCGGCCAAGATCTTGCGCGTCTCTGCTTGCGCCTTGGCTGTTTTTTGGTCGACTTCGCCC
TCAACTTCTTCGTCATCCTCCATGTCGCTGTCGCTCAGCTCGTCTTCATCTTCGTCGTCTTCGTCGTCGTCCTCATCCTC
ATCGTCGGCAACCCGCGGCTTTGAGCTACCCCGAAAGGTGAATTTCTGCACCATCTCCTCGTCACTCGAACCAAAGGCCT
CATCGCTGTCGATTTCCCCGTCATTGTCATTGTCGACATCTTCGGCACCTTCGACGTCAACATCCTCAGGGTCGTCAAAC
TCTTCCTCTTCCTCTTCCTCGTCGTCGTCATTCTCGTCGTCAAAATCGCCCTCGCTGTCTTGCTCAAGCTGCTCGCGGCT
CACGCGTGCGCCTCTGTAAGCTGGTCCTAATGACAGCGCCTGCTTTTGCCGGAGCTTGGACTTTCCAACAGCGACATAGT
GGTCGGTATCGGCCCCGACGGCGTCCTTGCCGTCTTCGCTTTCACTTGCGTCGTCCTCATCCTCAAGCGGCGCCTCTGCC
TCGGGATCAAGCTCTGTGGCCAAAGCCTAGTCAGCACACAAGAACATACTCCGACAGATGGACGCCTGAGACAAACCTTT
CACTGGGCGCTCTCCGGCGAAGAGGCGGGCACGACCCTTTGCACTCGGCATATTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62