GenePrediction:GLEAN_264 Details

Name: GLEAN_264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:611176..611977 (+ strand)
Length: 802
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:611176..611224 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_167:611412..611977 (+ strand)
Length: 566
>GLEAN_264 class=GenePrediction position=GCSC_167:611176..611977 (+ strand)
ATGACGCGAATTGCTGTCTATGGCACTGCTCTGGTGACCTTTACTGCTGGTGAGTACTTGACCTTTCGATTTTTCGATTT
TTCGATCTTTCGATCTTTCTACTCTACTCACTTTGTTCCTCTTTTTTACCTCTCTTCTCGCTCTTTTTCTGTCTATTCTC
CTCTCTCCTACCCTCTTCTCCCCTCTTCTCCCCTCTCCCCCCTCTCTCCCCTCCTCTTCCCCTCTAACACTCCCAGCGAC
GGCCATGACGATCGCCGCCAACCTGGTCCCCCGCTGGGTCGTCTATGCCGTCCCGCCGACCCCTGGCAGCGGCGCCCAAC
CCTTTTGGCAGACCCTCGGCCTACACCGGTCGTGCTCGTCCGAGGCCGTGCCGTCGTGCCGGCCGTTTCCGCAGACGTCA
CGTGACTGCAGCGCCGGCGCCGGCCAGCAATATTTCTGCAGCGTATGGCGCAGCGTGGGCTTCATGATGGCGCTGGCACT
CGTGGTCGAGCTCGCGGCGCTCGTCGGCTTCGTCGTCGTCATGGCCGGCGGTCGGCTCAAGCGCGAGAGCGGCTGGCGCG
TGCTCGGACTGCTGCTCGCCGCCGCCGCGCTGCTGCACGTCTTTGCTGGCGCTACCGTCGCCTTTCTGCGCGACCGCGAC
GACCGTTTTCTCGTGCCTGGCTGGCGTCTCGACATCTCTTGGATCTTCTGCATCGCCAGCGCCACCATCGCCTTCCTCTG
CGCCGCCGGCCTCGCCCTCTCCGCCCTCGTGCTCCCGCCCGAGGACGGCTACGAGTTCTTGCGCGATCCCGTTGAGTCGT
GA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62