GenePrediction:GLEAN_266 Details

Name: GLEAN_266
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:633844..635223 (+ strand)
Length: 1380
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:633844..634772 (+ strand)
Length: 929
Type: CDS
Source: GLEAN
Position: GCSC_167:634893..635223 (+ strand)
Length: 331
>GLEAN_266 class=GenePrediction position=GCSC_167:633844..635223 (+ strand)
ATGAACCTGGCAGGGTCTGCGCCGCTCTCTGGCGGTACCAGCAGCCAAGGGCATGTGCTAGCACCTCCTTTCGAGCACAC
CCCAGTCACTGCTGCCTTGACGTCGGCGAAGCCGTCCGTCAAAGGCAAAAAAGAAGAGAGTGGAGAGTCTGCCACCGGCA
GCGACGACAACAAAAAACACAAGAAGCGCGGCTTGTTTGGCTTTGGCAAGAAAAAGGGCGACGAAACATCTGCCACGTCT
CTATCAGTTCCATCCGCGTCCGCGGCTGCATCTGCATCTGCGGGTACCTCGACAACAACAATGTCAGGCCAAACAACGCT
AAACATAAACGCCAGCGCTGCAACGGGTTCGGTAGTTCCTCCTCAAACCCCCGGGGGCCCATCGGCGCTCCTACGGAAGC
CATCGTCGCCCTTCCAGGCGGAGAATTATATGGGTGCCAGTATCGCCAGTATGGGCAGTACTAGCGGTGGCTCTTTTGGC
CATGGGTACTACGTGCTGCCGACCTCGCCCGGCCGGACTGCGGCAGGGTTGTCCTCGTCACCGCGAGTGTCGTCACCGGC
GGGGTCGCAAATTTTTGAGCGTGACGTGCAAGAGAGCGCGCTGCTGGTACCAAACTCGCCTGCCATCCCGTCGCACATCA
CAACTGAGGACCGCATCCCGTCTGTGTTGGATGCATCGTCCGAAGTCATCACGGACGACCACCTAGACCCAGACTCGGTG
GAGATCATCACACACGCTCACCACCAGCCGGCGGTGATGGCTGTGGCTGGCATGGGCAACGCGGCCCCAGTTGCGTCCAG
CGCGGCTAGCGGCGTCAGCACGGGGGCTTGGGTCGACGACGTGGCCAGTAGCTTCGTCGACAAGGATGACAGCGCGTCCA
ACTACGGCTCATTTGACGCCACGGACATACGCCGGCTGAGCTTCATCTCGTTCGCGGATGTCGTGCAGGCAGAACAGCAT
CAGCACCAGCACCAGCAGCTTCTGTCGGTGGGCAGCGGCAGCGGCAGCGGCAGCGTTCACGAATCTATGCACCTGGCCGG
GCTGACCAGCTTGACGACGCTGAGCACTGCCGTCAACCGGTCGCCGTCGCCAATGCGATCCCCGACAGCGACGGCGACGA
GCCCGCCGACGAGCAAGAGCGGGTCGATCAAGGGCCTTGAGCTGTCACCGCCGAGCCGCAAGGCGACGATGGGATCGACA
TACTCGTCGGCGGTGGGGTCGCCCACGATGTCGGCAGTTGGCAGCACCGGTAGCAACGCGCTGCTCGGCGGGGAGCTGGC
TATCGAGACGATGACCCAGGCGCTGCGACGTACAGGTAGCGGGGATCTGAGCGGAGTGCGGAGCTTGCCGCAGAGCCCGA
TCGAAGGCACGTGGCGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62