GenePrediction:GLEAN_2675 Details

Name: GLEAN_2675
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2552193..2559333 (+ strand)
Length: 7141
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2552193..2552289 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_140:2552889..2555680 (+ strand)
Length: 2792
Type: CDS
Source: GLEAN
Position: GCSC_140:2555849..2555871 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_140:2556695..2556888 (+ strand)
Length: 194
Type: CDS
Source: GLEAN
Position: GCSC_140:2556951..2557902 (+ strand)
Length: 952
Type: CDS
Source: GLEAN
Position: GCSC_140:2557967..2558079 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_140:2558147..2559333 (+ strand)
Length: 1187
>GLEAN_2675 class=GenePrediction position=GCSC_140:2552193..2559333 (+ strand)
ATGCTCAGGCCGGCCGCCAGAAACGGCAGCAAGAACGAAACGAGCTCAAGGCTGCCCGTGCTCTGCAGCGAGTATGGCGT
GGCCATCGAGTCCGACGGTCTGTGAAGCTTGACTTCCGGCAAGCTCTATATGGTTTATACAGCGGGGCTGTCAATCTCCA
GCCGGATCAGAGAGCCGCTGTTGCCTTCCCCTTGCTTCTCGCTAGCTTCTCTAAAGGCGACGACTGCCAGCTGCTTGACC
GTTTTGCCGAAGATCTTGCTGAGACGGACTACGGACTTCTTTCATCTGGGAAAGTTCCCAAAGAAAGGCTGTGGCGCCTA
GCTCAGATCTTGATATCTACACTGGCTTGGTAAGCAGCTCCCAAGTTACACAAGTTGACGTCAAGTCGGGCCCATGTTTT
TTCGCTAACGGCATTTGCCATCCGATTCCATAGCGAGCCAGTCATAGGCCGACGATTGGAGCTTCTTATCCGAATCGTCC
ACATACGGCCTCCAGGCCTCCTCGACAGCCTTGGCTCCTACTATAGAATGCTGGCCAAATTCTGTGCAGAAGGGGGAAAG
TCACCAGCTCAAGTGCTTCTAGTAAAAAACGCTGTTGTTGCTCCCTTGCGGCCCAAAGACGATGTGCCAGGTATGAATGT
CTCTGTATATCATACTGGTCAACAAATCTGAAACTGACGGGGTACATTCCTTCTAGTCTCGTTCCTGCGTCGAGCATACT
CTGAATATGCAATGTCCTTCTTGACTCACTCGCTAGGCTTGTTGGAGCAGACTATCACTCTGTTTGCGCAAGACCTTGAC
TTTGAAGCCTTGTACCGAGCCGTGATAGAAGCTTATTGCACCTCGGAACGAGGGTCGGACAAAGCCCCCGATCGGTCGTT
GTGGTTACTTGCACACCTAATTGACCTTCAGAAGAACCAAAACGGCGAGACGCCGAGCACTCCGCTTTATCTTAGAGCCA
TCTACATGCAGCTTTCTGCTCTTTCTAGCACCATCCGAGCGCAGCTGCGTTCCTCTGCGACCTCTGACAGCAGGTCGTCT
CCACTGCCCGGTTACCTCTCATCTAGGATTGGCTCTCTCGCAGACAAAGATGAGGTGTCATGGCTGCTTGAGAAGTTCAC
ATCGTATGATCTTGCACCTTTCCTAGTTATTACCGGACCTTATCATGTGCTGACCTGGCAAAGGAGCCAAGCCGATGCTG
CAGGACAAGATTATGCCAGCCTACTAGCTGGGTATTCAATCACGCTCATCCGCTGCTTCCCACAGAAAGCTGACGACATC
CGTATGCGCCTATTTCTTGCAGATTTTCTGTCTGCGACTGGAGCACAACCAGCTGTGCAGTTTTTCTGGTCCGCCTCGAG
TGTAACAAAGCTTTTCGATTGCATTATTTCCTCTCCAAAGGGCGCACTGGACTTTCTGCTCAGAAGAAAATACTTCCCAG
CCTCATCGTCGGCGGCAGCAGACGATACCCCATGGGATCGCGAGTGGCGGACCGTCCTGCTATTTCTTGAGCTTTACACA
TTTGTCATGAGGCTGACCGATGACGACGACTTCTTCTCTGGTCTAGACGGCCGCTCTGCTTTCGAGGGCAATATGTCGTC
TCCGTCCCACATCCGTGCCTCTGCTCTCCGCCTCGATGCGTTACAACGGCTGTCTCTGTTCCTTAAAAATCTGGCTTTCA
CGCTAAACTACAACGCGGCAGAGCTCTTGCAAGGGAATGGAAACGATAGCAAGCCGTTCAGTGGATCGGCTATGAGCCAA
CATAGCCACTCTGCAGCCTATCGTGTTATCGCAGGCGTTGACTTCGGCGCTTTCAAGTCTCTTGTCACAACTTCCATACA
GATGCTTTATGAGCGGGACTCCCGCCGCCAGTTTTTGCCGACTGGGCATTGGCTCATGACGACGAACTTTGACATGGATG
GCTTTTTGTCAGCTGTTGTCTTGGAAGAGCAGCGGCAACACGAACTCGAAGAAGATGGTAGCGACAGCGAAATCGACGAC
AACGATGCTGGTGATGATGACATGACCGACGACATCGGGGCCGAGCAAAGCCAAATGGCTTTCTCCAACAGGCCTCGGAC
CACGACTTCTCGATACATGCATATAGAGCAGCTCCGAAAGCAGCACAAGAAGGCACATAGGGAGCGGATGCTTGCAGCCA
TTGGTCCTAAATTGGAGGTCTTGCGAAACATGCCATACGCTTTGCCATTCGAGCTTCGGGTTCGTATTTTCAAGCAGTTT
GTTTTCTTGGATAAGCAACGCCGGCGTCAAGGACATGTCGATCCCGACCAGTGGCGTCTATTCATCGCCAGCCAAAATAT
GGCATCGATGAACAGAAATCACACTCGCGAGGACATCCTCCGCCACAGCGCCAGGATCCGCCGAAACCTGGTGTACGGCA
GTGCGTATGAGCAGTTCTACCCGCTTGGAGAGGGATTGAAGGAGCCGATCCAGATCACGTTTTTGGATGAGTACGGATCT
GAGGAAGCCGGGATTGACGGTGGAGGTGTCACCAAAGAATTTCTCATGAGCGTAACGAAAGAGATTTTCACGTCGAAAAT
TGGCAACGTGATGCAGTTTCAGTCAAATAAGGACAACGCTCTCTATCCCAATCCACTGGCGCTCGACCAGGCCAAGTCTT
GGTGTCACGCCAATGGATTTCAAGGCGCAGAACAGCGCGACCATATTGCTGCGATGCTGAGCCAGTTCGAATTTACCGGC
CGCCTTGTTGGGAAATGCATGTACGAGGGAATACTACTGGATGTCGTCTTTGCAGGGTTTTTCCTTCTGAAATGGTCCTT
GTCGACCAAGGACTCGGCCTACAGGGCGAGCGTCAACGACTTGCGCGAGATGGATGAGGAGCTGTATCAAGGCATGTTGC
GCCTGAAGAATTTCAAGGGCGACGTGTCTGAAATGGATGTCAACTTCACCCTTGAGGACCAGGTGAGCATGGACGGGTTG
CCACTGCGCACAGAGACACGGAACCTGGTCCCAGATGGCGAAGACATTACAGTGACGAATGAAAACCGGCCTCTGTATAT
CTCGTACGTCGCGCGTCACCGGCTGGTTGCACAGCCTTATCAAGTGACAAAGGCGTTTCTTCATGGTCTCGAGACAATCA
TCGACCCCGCGTGGCTGCGCATGTTCAACCAAAACGAGCTCCAGCGCCTTGTGGGTGGCGATTCGTCGGAAATCGACGTG
CAAGATTTGCGGCAGAATACTGTCTACGGAGGCGTATACGAGATGGGCGATGATGGCCAGGAGCATCCGTCTGTCAAACT
GTTCTGGGACGTCGTGGGGTCCCTGCCTGACGAGGACAGGCGTCTGTTACTCAAGTTTGTGACGTCTACGCCCCGGGCAC
CGCTGCTTGGGTTCTCGCAGCTGAAGCCTGCCTTCAGCATCCGTGATGCGGGTGGTGATGAAACACGTCTGCCCAGTGCC
AGCACATGTATCAATTTACTGAAGCTGCCGCGGTATTCGAGCCTGAAGGTAATGAGAGATAAGCTGCTCTATGCCGTCCG
ATCGAACTCGAGATTCGATCTCAGTTGAAGGCTGGCCCGTATCTGGGGGTGTATTTCGATAAGATAAATCAGGAAGTGGT
GCAGTCTGTCTACGATGGAGCTACATTCCTTGACTAAATTTAAAATATAACATCAGGAACTTGGTGCATCTGCAACTTCG
TATGTTGGTCAAGAAGAAAGTGGACTGTAACATACGAGATAGGAGTCATACTTGTCTGTTTACTGTTAGATACCTGGCTC
TTCCTTGAAACTTTCCCTGTTCTCCATACGCTCGAGAGCCCGTACCTTTGGCGAAAAGGGTGTCTCAGCTAAAGCTAAAC
GCGATCATGCGCACGTACTCCGTACGATGACTTAAAGAGGAAGGCAGCACACAAGTGACTACTTCTAGATCTGTGCACTC
GGCAGGATTATGTAACTGGAAGTCTCAAGAGTTCCTAGTCACAAATCCAACTGGAAAATCTCATAGCTTCCCTAGACCTG
GCGCTTCACAATGCCGTTCCATGAAGCATTGTTAGCTCGACGACCAATTCTTGGCGTCAGGGGCGCATCTCCATAAAATC
CATGGCTTGGCAAAACGGGGCCTGAGCCTCTCACAGATCCAGCGGTCTGAACTGCCCGAAATAGGAAACAGGAGGTATAA
GGTAGCACTGAACTTTCTGGCTTTCTCCGTTCGCCCTTCTGCTTTTCGATTTCCTCACACGTCTTTATCATCCGACGACG
CGTTTTGCCCTGCTGGATCTACTACATACGATCCCCGTTTTCTTCATCTGAAGCTGTTCTGCACCGATTTCGGCATGTTG
ACGGGCGTCTTCAAGAACTAACGGTCCTTTAAGGTAAGGTCTGTGGCTACGCAAAACAAGAGAGCCAACAGAGACTGCAG
CATCCCATGAGGAGCTACCGGCTTGCCATGCCTCTTCCGTGCCGTCGCAGCTGCGTGTACATTGCTGTCTTTTGCTTTTG
TGCTTCCTGTTGTTGCTGCCAGGTCCACGACACCAAGTCAGCCAGGCGTTACTGTTTGCGCTTTTCCCATCCACGCTCCG
ATTATCCCCTTCTGGCCCGTTCCCTTTTCAAACGCTCTCGTCAGCCCCAATGGTTTTGACGTTATCCGCTACATCAACCC
TCTGATAGGAACTGTGAATGGCGGTCATGTCTTTCCAGGGGCTACGCTGCCTTACGGTATGTTGCGTACATTCTTCTCCA
CCAAATGGGCTTGTACAGAGTACTGAAGTCTATTATAGGCATGGCCAAAACTGTCGCCGACACAAACAGCAAGGCTGAGA
ATGCTGCTGGCTTCGTGTCGGATGCGAGCAAGATCACGGGATTTTCTCACATGCACGACTCCGGCACTGGTGGTAGTCCA
TCCTTGGGCAACTTCCCACTGTTTGTGCATTCTGGCTGTCTAGACGACGATTTTTCCAAGTGCAAGTTCAGCTCCAGGAC
TTGTAGTGTTGCTCGCATAAACGGCTCAGCCCGCGCCAGTCCTGGTTACTTTTCTGTCGAACTGGAAAACGGGGTCGCAG
CAGAGATGACCACAACCCAACACACTGCTTTGTATCGATTTACCTTCCCCACGGTGGAGGATGGAACTGCAGCGGTGCAG
TCCGACGGAACCGTCGTGCCACACAGCCCACTGGTCCTCGTCGAACTGGCCGATCTCGCGGTGACGCGCTCTGCAGGAGG
CATCCGGGTCCATGCAGACTCGGGTCGCATTGTTGGTGACGGCACGTTTCGGCCGTCATTCGGCACGGGCAGCTACGAGG
CGTATTTTTGTGCCGATTTTCAGGGCGCAAGCATCCGAAAAACGGGTATCTTCAACTCCATGGGCGTAGCTAAGGAGACC
AAGCAAGTCAGCGGAAACTACGGCTCTTTAGCTGGCGCCTGGATCCAGTTCGAAGCCCCATCAGGCCCCGGCCGTGATAT
TCTAGCCCGTGTCGGGGTGTCCTTCCTCTCCTCTGACCAAGCCTGTACCAATGCTGAATCTGAGATACCAGAGTGGGACT
TTGACGGCACCATTCTCGCGGCACAGGACGCTTGGCGGGAGAAATTGGCGTCCATTTCTGTCGACGCAACGGGAGTGTCA
GTCGAGATGCAGACGACATTCTGGTCAGGAATCTACCGGACGTTGCTGTCGCCACAGAACTACACTTGCGAGAACCAAAA
GTGGAAGTCAGATGAGCCGTACTTTGACTCGTAAGAGCTGTCCAGTCTCCTTTACCACATATGAATAACTGCGGCTCACA
ACTCACAACTGCAGGTTTTACTGCATCTGGGACTCATTTCGGGCCCAGCATCCTCTCCTCACCATCATTGACCCGCCAGC
CCAGACGCAAATGGTGCGTGCCTTGATTGATATCTATCGGCACGAAGGTATGTGCATATTTGTATTTGCTCTGCACTTAG
CCTGGTGTATCTCCCAACTCTGACAGGGATATAGGAAAGCTTCCTGACTGCCGCATGGGCTTTTGCAAGGGCTACACACA
AGGCGGTTATAATGCCGACGTGGTAATTGCCGACGCCTTTATCAAAGGGCTCGTTGACGACATCGACTGGGCCACTGCGT
ACGAGGCCGTCATCTCCGATGCCGAGGTCGAGCCGAGCTTTTGGGGAGTGGAAGGCCGCGGCAACCTAGAGAGCTATCAC
GTCTTGGGCTACATCCCTTGGGACGATACGGATACTAACGGCACCGGGCCCACGAGCCGCAGCATATCGCGTCTGGTGGA
GTATGCCTATGAGGATTTCACCATCTCTCTGATGTCGGAAGGCCTTGGCGATGTTATAGGCAATGCGCGGGCTTCAACTG
ATGCGGCCAAGTACCGAGAACGAGGCATGAACTGGCGCAACCTGTGGAACCCCGAGCAGCGCGATTCATTCCAAGATCCC
CCGGAAGCGATGATACCGAGCGACTTTGTGGGCTTCCTGCAGCCACGACTGCTGAACGGCAGCTGGCGTTACCACAGCAC
ACGGCGCTGCAGCCCGATTTTCGACATGCACAAATGCTACTACGACACGATTCATGAGACGTACGAGGGCAGCCCCTGGC
TGTATTCGTTTTATGCACCGCAGGATATGCGCACTCTCGTGCGGCTGATGGGTGGTCCAGCTGAATTCACGCGTCGTCTG
AAGTACTTTCACGAGTCCGGAATCGCCTACATGGGCAACGAGCAGACGTTTCTGCCGGTCTTCCAATTTCACTATGCCGG
CCGGCCCGGCTTGAGCTTCTACTGGGTGCACCAGTACATCCCAGCGCTGTTTAACGGCAGTGTCAATGGAATCCCTGGAA
ACGACGATTGTGCCATGGGTGCCTTTTCTGCGTTTGCCTTCATGGGCTTCTTTCCCGTGGCTGGACAGGACGTGTACCTA
CTGACGTCGCCCTTCTTTCCAGAGGTGCGCGTGCGGTCTAAGAACGGCCGTGATGCTATTTTCCGTGTGCTCAACTTTGA
TCCAACATACTCGGCCAAGTACATCCAAAGTGCCACCCTGAACGGCAAGCCTTACACGCGCAGTTGGATCAACCACGACA
TATTTTTGCAGGGCGGCATACTTGAAGTCCAGGTTGGTCCGGAGGAAAGCCTCACGTGGGGAGTTGAAGACGAGGATCTT
CCACCAAGCTACTGCTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62