GenePrediction:GLEAN_2677 Details

Name: GLEAN_2677
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2565412..2568144 (+ strand)
Length: 2733
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2565412..2566424 (+ strand)
Length: 1013
Type: CDS
Source: GLEAN
Position: GCSC_140:2566693..2567675 (+ strand)
Length: 983
Type: CDS
Source: GLEAN
Position: GCSC_140:2567792..2568144 (+ strand)
Length: 353
>GLEAN_2677 class=GenePrediction position=GCSC_140:2565412..2568144 (+ strand)
ATGGATATCAGAGATCTTTTGGTTCGGCATGAAAAGCTTGTCCATCTCAATGAGAACAGTCGAGATGCAGGAAGAACTCG
AAAAGCTTCTTCTGTCAGCGGCCCCTCTGGATCTTCCGGCAGCAGCAATACAGAGGTAGCTGTTGGGCTCCAAAATCGGT
CTCAGCAGTCCGGATTCAGCGACCCTGCTTCGTCTTCAATATCTCCGCCCCATGCCGCCTCTGCACTGCTGTCGCACTCT
TCCTCAGCCGACCCGCGGCTCTCATCGAGCCTGGACTTGCTCTCCGATGCCGCCACACATCTCGCCTCTTCATCCGGGAT
AACAAATATGCCGCCCATGATACCCGTTCTTACCCAAACATCCGCTGCCACCATGACCCCAGTCAAGGCATACAACGAAT
CCACACCGCCTCCGTATGGCGACCGCAGACGGGTGTCTGCCCAGGCAGATGTGCTTCTACAAGCATACCCTGGCCAGCCC
CCTGCCACCTCTTTTGACGACTACCACTTGTTTTTGGACGAGTTCGCGTCTTCGTCACACTTCTTACCACCATCGCTCGA
GGCAGATCAATCGTTGGGTTTGTGGTCGCGACCGGCGGCTGAATTACTCGGACGCGGAGTGGGTATGACCAAGATGGCAC
CCTCATTCCCTTCAACAAGGTTTCCTTCTGTTCAGCCAGACATGCGTGATCTGGCTGCTGAGACTGCTGCTACGCGAGCA
CAAGAAGAGATGGCAATGCGGGCGCCGGCGTGGAGGATAGCGGGTACTGATCACACCATCATTAAAAACCGCCTCGAAGA
ATTCACATCGGTCCTGCCGGCCGATTTTGTTTTCCCTTCGCGCCACACTCTGACTAGATTTCTTGAGGGCTATGTCAGCG
GACTGCACGAGCACATCCCGTTCCTGCATCTTCCAACTTTGGTACCGGCTGAGCTCTCACCCGAGTTGATACTGGCCATT
CTCGCTGTTGGAGCTCATTACCGTTTCGAGAGTCACCGTGGCAATGCACTCTGGTATGCGGCAAAAGCTGTTGCTTTTGA
ACAAATCCGCCGTCGGCACAGCCATGAGCTTCACAGCCTTCTCCCAAATGCTTCCGCCTACAGCCCGCATTCGACTCGGC
CGTCGCCAAGCTCGAGCTATAGACATTCTTTCAATTCAATGCAGCATGATCGTCCCATGACGCAAGAAACCCACCGAGAA
CCTTAGTATGTATTTCCCATTCCAATAAGCAATTGCAAGACAACTCTGACATATGGCCTCGCTCCGTTTCTCTGTTTGCA
GCTCGCCGAATACGCCTCAGTCTCGTCTTGAGACTATCCAAGCCCTCCTTCTGTTATTCTCTGTTGGTATCTGGGGACCC
AAAGCTATTTTGCACGAGGCGCTATCCCTACAGAGCACGCTTGCACTTCTTATGCGGGATGACGGCTTGACATCTGAGAC
GTCGGCACAGGCGGCTGACTGGGAGACATGGATCCGGTTTGAAGGCAGCACGCGCACAAAACTGATCGCGTTTTGTTTTT
TCAATCTCTGCAGCATTGTTTACAACACGACGCCCATGCTTCTGACATCGGAGGTCAACCTGTTTCTGCCACAACCCTCC
CGGCTCTGGCGGATGGAAACACCTTGGCAGTGGCACACCACTCGTCAGGCATACCCAAACGTGGAAATATCGCTTCAGGA
TGCGTTTTCTCGCATCTTGAATCGAAACTCGCAAACACCCCTCACCCATGTGTCGTCTCTTGGGAATTACGTTCTCGTCC
ACGCCCTCATTCAGCACATCTTCCTGCTGAAGCAAACGTCCTTTGCTGTATCGTCGCACTTTGGTGTTCATCGCGGACTC
AAATCAGAGGATGTCGAGGAGGTGGCACACGGCCTGCGCATGTGGCAGATAGGGTTTGAACAACACCGTCAGATGCGCGA
TGCCGAAACAGCTCAGCAGCAGCAGCAGCAGCAGGCAATGGGAAGCCTCGGACTGATGCCCGGGTTTGACAGTTTTCCTG
GCAGCTCGGTGGCTGTAAATGCGACTGCCCTGCTACGGCTGGCATACATCCGTCTATATACAGACCTCAACCCTGGACAG
AGGCTAGAGAGTCGGGACCCCATCTTGATCGCGAACGCATTCAATGACGGGTCTCTTCTCGCTCGAAGCCAGCGTACGAC
ACGGGCAGTGGTGCAAGCTATTCATGCTTTGGCCATGCTGGTCAGGGCCGGCGTGAACTACGTGGCACGGACAAAGTCGC
TTGAATGGAGCATGCAACATTCTTGTGAGTATGATGCCCGTTCCTCTTTAGCCGAAATCTAATGAAATATATCGAAATAG
TATGCAATATGGAGTGCGCCATTTTGTTATCGAAATGGCTCGTTACGCTTGCCTCTATAGGTCCCACGGACCCCCCCATC
TCGGCGGAGGAGAGGGCACTTTTGGATAACATGCGGCGTCTTCTGGATGAGACTGAGTTTGCTGTGCCAATCGATCCTTC
GTTGGTAGGTACGTCGTTGTCGTCTGGACATGCGTCTGGCGGGCAGCAGAACGGCGTTTCGAGTGACAGTGCCAAGCTGC
GGCAGCTTGCTGCGGCCGTTATTCGCCTCTGGGCCGAGACGTTCAAAGGCGCGCATATCTTTGAGGTAGTCAGCATGATG
GGCTTGGGCCTGGAGAGCTACGCAGATATGATAGAGAAGCAGCGCGAGCACACGCCGCTTTCTCGAATTTCTACCACAGT
TGGTCTTTCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62