GenePrediction:GLEAN_2679 Details

Name: GLEAN_2679
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2579538..2581112 (+ strand)
Length: 1575
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2579538..2580022 (+ strand)
Length: 485
Type: CDS
Source: GLEAN
Position: GCSC_140:2580068..2581112 (+ strand)
Length: 1045
>GLEAN_2679 class=GenePrediction position=GCSC_140:2579538..2581112 (+ strand)
ATGTCCTTTACCCCCCCTCGGTCCATCTTGATCATCGGTAGCGGCGTCTTCGGCCTTAGCACGGCCGACGCCCTGACCCG
GCGTCCCGACTTTGCCCATACGACCATCACCGTTGTCGATCGTGGCTCTGGCTGGCTTGCAGACGGCGATGTCGCCAATG
ATGACGATGACGACCGTCACTTTCCCGCCCGCGACGCCGCCAGCATTGACAGCTCGCGCATCATCCGCCCCGACTATGCC
GATCCGGCCTATGCGGCCCTAGCAAACGAGGCGCAGGCGCTGTGGCGGACGCCCGTTGACACTAGCCAGGACTACATCGG
CGGCGACGGTCGTTACTCGGAGTCGGGGCTCGTCGTTATTGCCGACGCAGATGTCGACGGCCACGAGAAGCTGCCGGGCC
AGAAAAAGACCGGCCTGGACTACGTTCGCGAGAGCTGGGCCAACGTCCGGGCCATGGCCCAGACCGATTCCTACCTGGCC
GAGAGGTGAGTCCAGAGGAAGAGAAGGAGAGTCCATCGGCTGACTTCCAGACTCAAACTTCTGCCTGATCCAGAGGCCAT
TCGCGCTGCCGTCGGTACTGGCGGTACTACCGGTTCTTGGGGCTATCTCAACGGCGCCAGCGGCTGGGCCAATGCCGAGG
CCAGCATGGCTTGGATGCTGAAGCGAGTCCGGCAGACTGGTCGCGTTCATTTTGTTCGTGGACGGGTGATCTCGCTATGT
AAAGAGATGACGTCAACAACGACAACCGTCACGGGCGTCGCTCTGGACGATGGCCGCACTCTCACGGCTGATCTGGTCGT
CGTCGCTGCTGGCGCCTGGACAGAGGCATTGCTAGATGGTGCTCCCTCGTCCTCGTCCTCGTCTTTGTCCTCGTCCCCGT
CTGGCCTGGTTGGCTCTCTCGCCGCCACCGGACAGGTCCTCGGCTATGTCCCGCTGGCTGCTGATGAGCACGTCCGCATT
GCCACCATGCCTGTCGTGCTAAATCTCAGCAGCGGCTTGTTTGTCATCCCGCCCGCTGCCGACAGTCACGTGCTCAAGGT
CGCTCGCCACGGCTATGGCTACATCAACCCTGTCCCATCGTCCTCGGCCCCGTCGTCTGTCCTCTCAGTGCCCTTCACCA
CCCAGGATGACCCCGACCTCCAGATCCCCAAGGAAGGCGCCGACGACCTGCGCCGCGGCCTCCACGACATCATCCCACTG
CCCGGCCTTGCGAGCCGCCCCTTTGGCCGCACTCGCATCTGCTGGTACACTGACACGCCTACGGCCGACTTCCTCATCGA
CTACCACCCCCACTGGAACGGCCTCTTTTTCGCCACCGGTGGCAGTGGCCACGGCTTCAAGTTTCTCCCCGTCCTCGGCC
CCAAGATCGTCGACTGCATCGCCCGTTGCCCCCCCGAGGCCTTCCGCCAGAAATGGGCCTGGAAGCATCGCCAAACCACC
GTCGTCGAACCGGAACAAGACGCCGGAAAGGACACTACAGCCTTCTGGAAGGCTGTCGTCTGTCACGACGGAAGCCGTGG
TGGCCAGCCAGGTCTGATTCTCCAGGAGGAGCTCGCAAAGGCGTCTTTGCCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62