GenePrediction:GLEAN_267 Details

Name: GLEAN_267
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:636838..638754 (+ strand)
Length: 1917
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:636838..637780 (+ strand)
Length: 943
Type: CDS
Source: GLEAN
Position: GCSC_167:637835..638754 (+ strand)
Length: 920
>GLEAN_267 class=GenePrediction position=GCSC_167:636838..638754 (+ strand)
ATGGCACACGACGAAAAGGCAGCGGCTCAGGCTGCCCAAACCCCGGAGCTGGACTCGGACAGTCACGAGATGTCCGGAGA
GAAGCAGAACGGGCCAGAGACTGCAGCGGCAGAAACACAGGTCGATGCCCGGCTAGAGAAGGCGGACGGCGAGAAGAAAC
AAGCTCGACACACGGAGACGGAAAAAGGGGATTTGGGCCGGAGCCGGCGGGGGTCGCAGTCCTCGGAATCGCCGTCGATA
TCGGCGTCGTCGACCACATCGGACGGACAGACCAAGGCAGCGCTGGGATCGAGCTCAGGACCGGACCCTGGACGCGGCAG
CGGCAGTCAGGCGCTGGACGAGGGGCCGCGGCTGGCGCCCATTGCGACGGCCACCAGTCGGATGTCGGTAGCAGCAACGG
TGAGGGCGACGGTGAGCGGCGAGGGGGCAGACCAGCCGGCGCAGCCGTGGTCATCGTTTGTAGAGATCCCCGACTCATTC
TACGACCGGCTGAGCGCACGGCACAAGCAGGCACTGGTGGGCCTGCTGTCGTTTTGCGGATTCCTGGCGCCGATCTCGAG
CACGGCCGTGCTGGCAGCCATCGCCGAGGTGGCAGACGAGTTCGAGACGACGGGAACGGTGATCGACGTCAGCAATGCGC
TGTACATGCTCTTCATGGGCATGTCGCCGCTGATGTGGGGGCCGATGAGCGAGGTGTACGGCCGGCGCTGGATCCTGCTC
AGCACGCTCGTGCTCTTTGTCGGCTGCAGCATCGGCACGGCGCTGGCGCCCAACATTGCGGCGTACTTTATTTTCCGCAT
CCTGACCGCGTTCGAGGGCACGGCCTTTATCCTGGTCGGCTCAGCGTCGATCAGCGACATGTACCGGCCGACCGAGCGGG
CCACCGGCATGGGCTGGTTCCTGTCCGGGACGCTCGCGGGCCCGGCTCTGGGGCCTTTTATCGGTCAGTGAGGTGCTTCC
TTGTGGCTCCCCCAAGTTGCTGACATAAGCACGCTAGGCGGCATCATCGTCACGTTCCGGTCGTGGCGCGTCATCTTCTG
GTTGCAGACAGCCCTGGCCGGGCTGGCTCTCGTGGGTGTGGCCGTGCTGATGCCGGAGACGATCCACCACAAGAAGATCC
GGAACCTGGCCGGCCTGCGGACGTGGGCCAAGGCGCGGGTGCTGTGGTCGATGGTCAACCCGGCACGGGTGATCCGACTG
TACGTGTACCCCAACGTGATGCTGGCGGGCATGGCGTCGTCGTCGCTGGTGTGGAACCAATACTCGCTGCTGACACCGAT
CACGTACGTGCTGAACCCGCGGTTCGGGCTGACGACGCCGCTGCAGGCCGGCCTGTTCTATCTGGCGCCCGGCTGCGGCT
ACGTGACGGGGACGTTTGTGGGTGGGCGCTATGCCGATCACGTCGTGCGGCAGTGGATTGTGCGGCGTGGCGGCGTGCGC
ATTCCGGAGGACCGGCTGCGGTCGGCGCTGCCCTTTCTCGGCATCGTGATCCCGGCCTGCATGCTGATCTACGGCTGGAG
CGTCGACCGAGCCGTCGGCGGAATCCCGCTGGTGGTCATCACCATGTTCCTCCAGGGCGTGGCTCAGCTGTTCTGCTTCC
CCAGCCTCAACACGTATTGCCTCGACGTGATGCCTGAGCATGGCAGCGAGGTCATCTCGGGCAACTACTTTGTGCGCTAC
CTGTTTGCCTGCGTCGGCACCGCTGTCGCCCTGCCGGCCATCAAGAGCATCGGCATCGGCTGGTTCAGCACCATCTCGGC
CGCCTTCCTCGTCCTCAGCGACCTCGGCCTGCTGGCTACCGTGCACTGGGGCGCCGAGTGGCGCGAGCGCGTCGGCCGCT
GGCGCAACGAGCGGCGCAGGGCCGAGTACAACCGGGCACAGGCGCGGAGAGGCGAACCCTCCGGCACGGCCGTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62