GenePrediction:GLEAN_2681 Details

Name: GLEAN_2681
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2610104..2611022 (+ strand)
Length: 919
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2610104..2610248 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_140:2610308..2610381 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_140:2610447..2611022 (+ strand)
Length: 576
>GLEAN_2681 class=GenePrediction position=GCSC_140:2610104..2611022 (+ strand)
ATGGCCTCCCACACTGAAGATGCCGTCTTTGAGTGGCGCCCGGCAAGTCTTTTCCGGGACGGTCCACTATCTGAGCCTTA
CGCAGTGATCGTCCTCAACCAACCTCTACGGAACCTGCGTTCAATTAAGCATGTCTGGGCGCGGGGTACGTTGCCCCATC
CACCACAAGTATGCGAGCACGCTCCTGTTTCTGACTCTACGTAGCATCGTATCGCGTGGCCGCGGATGGAGGTGCAAACC
GGCTGCACGATTCTCGCGAGGCGGCAGGCGAATCATTTGTTGGTATACCGGCGGCCGATGAGGGAAGTCCGGATGGCAAC
ACAGCAGCTCACACAGTGCACAGGAAAACCTCAATGTCATTATCGGGGACCTCGACTCGTTAAGGGATGAAACACGCGCA
TACTTTACGTCTCTCGGCAGTGCTGTTGTGCATGATCCGGACCAGTACTCGACTGATTTCGGCAAGGCTGTCAAGTACAT
CTGGGCGCAGCACCCACAAATGCACATAATCGCCATTGGCGGCCTGGGCGGACGGGTTGACCAAGGCGTGAGCCAGCTGC
ACCATCTCTTCCTCTTCCAGGACGATGGCAGCAGCGGCAAGGACGGCATCGACCGCCGGATGTACCTCCTTTCGAGCGAG
AGCATCACATTTTTGCTGCCAACTGGCCGGCACTGCATCCATGTCCGGGAAGAGTCTGGGCCTGCCACGGCTGACGTCTT
TGCCAAGTACGTGGGCATCCTTCCGATGCAAGGGCCCAGCATCATATCCACAAAGGGACTCGAGTGGGATGTGACGGATT
GGAACACCCAGTTTGGCGGCCTTGTGTCGACGAGCAACCACATCCTGCCGGATACGCGTACGGTCGAGGTCGAGACAAAC
CGGCCGGTGGTCTTTACCGTTGCATTGAAAGACACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62