GenePrediction:GLEAN_2682 Details

Name: GLEAN_2682
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2616732..2619140 (+ strand)
Length: 2409
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2616732..2617658 (+ strand)
Length: 927
Type: CDS
Source: GLEAN
Position: GCSC_140:2617785..2618652 (+ strand)
Length: 868
Type: CDS
Source: GLEAN
Position: GCSC_140:2618761..2619140 (+ strand)
Length: 380
>GLEAN_2682 class=GenePrediction position=GCSC_140:2616732..2619140 (+ strand)
ATGGAAGCACGCACGAGTGTCCCTCCACAGACGCCCATCGATCTTCTCTGCTCGCTGGACGACACGAGAAGACGCGTGTA
TTTTTTCTGTCTTGGTAGGCATCCCGGCCTTGTGGCATCGCCGGCCTGTGGCACACATGCTGACCACGAACACGAGGCAG
AATATGCTGTAGACAGCGCTATACGCGGCCGAGGAGTCCCGTCGGCCGAGACGTTTGGGCAGCTGACAGGCCAGACGAAC
ATCACGTCGAGCGTGACGCAGTTTGTGCAGGGCCTGGAGGGTGGGACAGTTCTGCGAGATGCCTTTGCGGCCGTGGAGAC
GCTGAAGCCGCTCTTCCTCAGCCTGCCGCCGGGCCAGGCGACCAGCCACCGGGTATCGACGGCAGCGACGGGAGCACGAA
TGAGCGACCGGCCGCTGGGCGGAGCGACGATGCGCGACGGCCGGTCCGACACGTGGGAGCGGCGGCTGGCCGACAAGGGA
ACGTCGTACTATAGCGGGTCAGGGCCGCTGATCGGAAATCAGTACGAGGCGCGCGAGCTCCGGGCCGAGTATGCCAGTCT
CAACTTTAAGGAGGTCACGGGCGACCGGCACGAGGCGTCGCCGCAGTTTCCGCAGGCGATCGAGGAGCAGCGGAAGCTGG
TCGGCCAGCTGTACGATGCCATCAAGAGCATGGATAACATCCTGGAGAAGAAGCGACCGATCTCACTGAAAAAGCGGAAG
CAAGGCGGCGAGGGCGAGGGAGGGGGGAACAGCAACGGCGAGAGTGTGGACAGGAACGAAAACGGCAATGACCAGAACGA
GGAGGAGGACGACGATCAGGTTGCGGGCCAGCAGCTTGGGAGACCGCAGATCAAGGAGTCGGTCAGCGTGCGGAAGGTCA
AGGGACTGAGCCGGATCGAGGTGGAGATGTTGTGCTGGGATCTGTTAGTGAGTATTTTTTTCTTTCTTTTTTCTTTTTTT
TCTTTTTTTTCTTTCTTTCTTTTCTTTCTTTTTTTTGTCTTTTCCTTTCCCCCAGCTCTTACCCCCCCTCCTTCATCCAT
GCTGACGCAACAGTTTACCGTCCGCGACATCCACCGTGGTCGGCTGCCCTTCCAGCCGTGGAGCCGGAATGACTGGTGCT
GGGAGGGCTCCTTTGTCTCGTTCGGGCAGCGCTTTGACGCCGTCGTCGAGACGCTCCGTCAGTCCAAGGCTGCCGTCTGC
AGCCTGCTCGAGTCGGACAAGATGGCCCGGCTGGCGGCGCACCCGCGCCGTGAGTACAAGCGCAAGGAGAACAACCGGTC
GCAGAACGCGGAGCGCAACGCCCAGGTTTTTGTTGGCCGCCACGCCATCGAGACCCAGCAGGTCCAGGTGAACCGTCAGA
CCGGCGACCTGCAGGACCGTGACGGCAACGTCGTCGCCGCCGCCGCCCACGACTGCAGCGGCCTGATCGAGCAGACCCGC
CGCCTGGCTGATCCGAGCCGCCGCGAGGCCAAGCGCGTCCGCTTCCTGGCGAGCATTGCCGAGAGCGGCGAGGGGGCAGA
GGAGGAGACGGGACGAGGACGGACAGAGAGTGCCGACGGAATCGACAGCTTGGCCGGCAGAACAGAAAGACTGCTGGCTG
CACCGCCGGCCGCCAACAGCACGCAGCTCCAGGCGGCCTGGCTCGCAGACAGCGAGACAAAGCCTCTCGTCGGCAACCTG
GCAGCAGCAGCCCAGACGACCCCAGACAATCACCTGGCAGACATCCTCAAGGTCGAGGAGCCTGTCGGCCGGCAGACGCA
CGTGCAACATCCCCTGCCGGCCGATGCTGGCTTCCCGCTCTGGCTGCAGACCGCCTGTGTGGACGCGCCCGGCTTCTTTG
GCGGCCACGTCGCCCAGCTGTTGGACCAGCCATACATCTTTGGCACAGACACAAACACCTCGACTACGGCACCACCAGCT
CGTCCCTCTTCGGCCTCATCCTCTTCGTCACACTCGACCCTCGCACACGGCCCTCCATCTTCCCGACATGTCTCGGCGGC
GGCTTAGGAAGCCCAACTGCCAGTATCAGCCGGCGAAGACGGACTGGCATCGCAAGGTGAGGATCCGCACCAGAAGCAGC
AACAGCAAAATCTCGTCCATGTCACAGACACAGCTGTCGATGCCGAGACCGAGCCGTGGCATGACCTCCACCAGCTGCAG
ACTCTCGGCTACGGCGTCGACCTCGAGCTGATGCCGCAACAGCCGTTGGGGCCGGCTCTGGCAGCGACTGTGGCGGCTGA
CACAAGCTTCGAGCTCGAGCTGGACCCCGGCTACCTCGGCCTCACAGACACAGAGCTGGCCGCAATTGCCGACTATAGCG
ACGCAACCGGGGCGCTCGAAGATATCGGCCACTTCCTTCGCTGGAGCTCACCAACTGATGCCGAAGACGGAGAGTACAAG
GCGAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62