GenePrediction:GLEAN_2683 Details

Name: GLEAN_2683
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2621243..2622767 (+ strand)
Length: 1525
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2621243..2621307 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_140:2621393..2621781 (+ strand)
Length: 389
Type: CDS
Source: GLEAN
Position: GCSC_140:2621893..2622767 (+ strand)
Length: 875
>GLEAN_2683 class=GenePrediction position=GCSC_140:2621243..2622767 (+ strand)
ATGTTGGCTCGATCGGCGAGTGGGCCTGGCGGTCTGAGCATCAACACAGGCTCTGCCAACCTCTTGTACGTAGCGTGTCT
GCGTTGTCTAGCGGGAGCATGAGCCCTGCATCCAGCAAAGATTGCTAATTTTTTTTGTCACCTTGACCAGCGGCGGCAGC
ACCACGACCAGCCAGCCTCAAGCCGGTGGACTCTTTGGCAGCACGACCACACAAGCCGGAACAGCAGCAGCAACGACGAC
AGCAGCGGCCACACCATCCATGTTCGAAGCGGCGGCCGGAACCGGCACCACGAGCGCGAGCGGCGGACTCTTTGGGCAGG
CGGCAGCAAAACCGGCGACCGGAGGAGGGCTCTTCGGAGGCGGTACAGCCATGGCGCAGCCAGCAGCAACAGCAGCAGCA
GGCGGTGGCGGTCTGTTTGGGGCGTCGACGACGACGGCAGCTCCTGCAGGAGGGCTCTTTGGGACAGCGGCACCGGCAAC
AACGCCGGCCAGCGGAGGCGGTCTCTTCGGGACAGCTGCACCAGCCACGACGGCAGCCGGTGGAGGCGGCCTCTTTGGCG
GCAGCAAACTGGGGATGATGCAGCCTCCGGCACAACCACAGCTGCAGCAACAACAACAACAACAACAACAACAGCAGCAG
ACCGTGCCAGGGGTGCGGATCGATGTGAGCAACCTCAAGGGCACGACGCGCTTCAACGACCTGCACGAGAGCCTGCAGAA
GGACATTATGGCGTTTGACAGCCTGATCCAGTCATATGTGGAGCAGAAGAACCAGGTGGCGGCGTTTCTGCCGGCACACG
GCGAAAGCCTGGCGGCGATCCCGGACGACGTGCGGTTTGTCGGGCGCAAGTACGACGGGGTGTCGAGTGCGCTGGGCAGC
GACCTGCAGGCGATCCAGGTGCTGCGTGAGACGGTGAAGCAGGATGCCGAGCATGCACAGCTGAGCTTCAAGGCGCTGGA
CAACCAGAAGCTGCCGGCTCAGTTTCACACGTCGGGCCTGTGGTCGACGGCACCGGGCGGCGGAGGAGGCGGTGGTGGAG
CGGCCAACCGCAGAAACCGGGATGGCAGCCGGAGCCGGACGCGGACTCGGCGTGGCAGCGCTGGCGGTGGTGTTGGTGGC
CGTGGCGGCGATGCGGACGACCACAACAAAGCGGGCGACGACTTTGGCGGCATCGACGGTGAAGGATCGTCGGGCGGGAC
GGACCTGATCAACTACTTCTCGCAGACGGGCGACGAGATCGGCGGACAGCTCCGACGGCTGGAGAAGAACCTGGGCGAGA
TTGAGGTGCACATGTACGGGGTGCAGTCGGGCCTGTTGGAGCAGCTGCAGCGGGTGGCGCAGGACGGTGGAGGCAGCAGC
AGCAACAACAACAACGGCAGCGGCAGCTCGGCCGAGGAGAAGGTGGCCGAGCTGGCCGGCGTGCTGCGCGAGTTCGAGGA
CAGCATCCTGACGGCGGCGAGCGTGGTGGGAGCAGCGCGCGAGGACGTGACGGCACTGCAGCTGGGACGGTATCTTGGGC
ATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62