GenePrediction:GLEAN_2686 Details

Name: GLEAN_2686
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2635295..2638635 (+ strand)
Length: 3341
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2635295..2635354 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_140:2635509..2636330 (+ strand)
Length: 822
Type: CDS
Source: GLEAN
Position: GCSC_140:2636482..2638635 (+ strand)
Length: 2154
>GLEAN_2686 class=GenePrediction position=GCSC_140:2635295..2638635 (+ strand)
ATGGAGCAGGGCATGCCTCTGAAGCGAAAGCGGCGGCGCAGAACGCTGGCGTGCGAAGAGGTGAGCATCGGGGGGGGGGG
GGAGTGGGATAGGACGAGAAACGGGCGATAAGATGGAGGACAAAAAAAGGACCTCAAGCCAGCGGACGGAATAGACCGGA
CAGACCGGACAGACGCGCGCTGACAATGAGCATCTACGCCCGCCCCGACCGCAGTGCCGACGCCGCAAAGTCCGATGCGA
TCGCGAGCTGCCGTGCACCAACTGCGTGCAGGCTTACAAGCCGGAGCACTGCTTCTACCAGCCCGACCCCATGGCGGCAC
GGTCGCCGCCGCCGCGCCAGACCGAACATGAGCAGCAGCCACAGCAGCCACAGCAGCAGCAGCAGCCGCACCAGCAACAG
CCATCAGCCGGGCTCCACGGACTGGCTGCCCTGAGTGGAGTGGCTGCCGGTGTCATGGCCGGCACGCTGGAGTCGGAATG
GCCGGCATCGCCGAGTCCGGCTCGCTACCACGGTCACAGCCATGGCAACCACCATGGCTACAGCCACAGTCACGGCCACA
ACCACGGTCACGGCCATCATAGCCGTCATGACCACCACCGCTACCTGTCGCCGTCCAGAGGCCTCCTGCCCGGCTTCTCG
TCCGTTTCTGGCAGCGAATCTGAAGTGTCGGCCCTCAAGGATCAGGTTCGCCGCCTTGAGAGCCGGCTGGCATCCGTGCT
CGCCGGCCAGGACCTGCCGCCTCGACCACCCTCGGCACAGACCACCCGCACGGCCCCCATACTGCCGCCTCTGTCGCCCC
GTCCGCCCCGGGCTGCTGGTTCTACGCCCGCACACACGCCCACGCCCTCGTCCACGCCGCTGCCGCTGCCGCTGCCCGTG
TTGCCGCCGCCGACACAGCTGCTGACCAACGGCTACCGGCTGGGCGGCCCCCTGGATCAGACCCTCGACGGGACGGGCGA
GAAACAGTACCACCGCGACAAGACGCAGTACATCAGCCGGGGCCACTGGATGAATGGCGCGCTGCTGACGCTCATGGTGA
GTTCCTTCCTCCCTTCTCGGGTTTCGATACTTGTGTCGCTCCTTCCTGTTTTGCTCTTCCAATCCCATCATCTTCTCTAT
CCTTCTGTCGTTCCCCCCCTCCTATTCTCCCACCTCTCATCTCCCGTTCATCCCACTAATTGTCCAGAAACCCCTATTCG
AACAAGTCATGCGCAAACCGGAGACCAGGAATGGCCTCGAAAAGTGCAAGTCTCTTGGCCGTACCATCAAGGCCAACCGC
ACACCATCGCTTCTGCAAACACTCGACGTCGGCCGTCACGTGCCTGCACGCCAGCTCGCCGACGAGCTCGTCAGCTGCTA
CTTCCGCACGTTCGAGTCCGTCTACCGCATCCTCCACATCCCCACCTTCATGCAGGCCTACCAGCGCTACTGGGAGAAGC
CCAGTGCTGCCAGCACCGTTTTTATCGTCCAGATGCAGCTATGCATGGCCATTGGCGTCTGTTTCTACGACGACACCTGC
TCGCTGCGCCATCTGGCCGCTCAGTGGATCTACGAAGCCCAAGTCTGGCAGATGGCTCCCGCACAGTCCGAAAAGGCGCG
CATGACCGTCGCCGGCTTGCAGACAATGTGCTTGCTGCATCTGGCTCGCGAGACCTCCAGCGTTGGCGCTGACCTGTTGT
GGGTTTCGGCCGGCAGCCTCATCCGCTCTGCCATGTACCTGGGCCTGCACCGTGACCCCAGCTGCATCCCCAAGATCCCG
CGTTTTCTCGCCGAGATCCGCCGCCGCCTCTGGGTCACCGTGCTCGAGCTCTCCCTGCAGTCCAGCTTCAGCTCTGGCGG
TCCACCCCTCGTTGATCTCGACGACTTTGACTCGCTGCCGCCGGCCAACTTCTTTGACGACCAGCTCGCCGAGAAGAACT
GCACGTCCGGCTCCGTGCCCGAATCCGGGCCTGCCTCGACAGTAGGAGCATTGCCTCCTCCCTACCCGCCTGCAACCTTC
ACCGACACGTCCATCCAGATCGCCCTGTTCAGGTCCTTTCCCACCCGCTTGGCCGTCGCCCACAACGTCAACGACTTTCG
CAACCCTGGCTCCTACGACGAAACCCTTCGCCTCAACTCGGAGCTGCGCTCCGGCTGCCAGTCCCTCTCGGCCACCATGC
AGTCCTTCTGTACCGCTTCAGGCACGGGCAAGATGCGACCCTCCACCTTCCACCTGCGCCTCGTCGAGCATCTCACCCAG
CGCTGTTTCCTGTCGCTAAACCAGGCCTTCCTAGCTGCGTCCCAGAACGATCCAAAGTACTACTTCTCGCGCAAGGTCAG
CGTTGACACCGCCCTGAAGCTGTTTCAGGGTTGTGGCAGCTGTCAGACAACATCTACGGGCGCGAAATCTCTTGTGCCAG
ACAGGGGCACCACACCACCACCCTCTTCCCACTGGAGCGCAATAATGACGAGCAACAGCAATGGCGACTCGGGTGGCGGT
GGTGCTTCTGTCTCATCTGTATCTACATCACCGGGATTGAGCAGTCGCGGATTACGGAACCATGGCTTCCCGTTTTCGTC
TGGCATCGACATGGCAGACGAACCAACCGACTTCCACCGACTGTGTGTCACCGCATCGGGCGCCTTTCGCTCCGTGCCCG
TGCAGTGTTTTGCCACCCTCAGCATGGAGCTTATGTGGCAGTTGGAAGAAGAGCATTCTGCGCGGCTCAGTCTGGGTATC
GTCGGCGGTCGTGGCACCTTTTCGGCCTCCTCGTTAGCTGCCGAACTGGACCCCAGCGCCTCTACGTTTCTCGCCATGCC
GGGCGTCATGGCGCAATCTGTGCTTCTAGAATCGGTAGAGCAGGCCGTCCTCTTTACGGAGAAGCGCGTTACCGCCGGCG
AGACAAACGTGAAGGGCATACTGTTCCTATGCGCCGTGCTTTCGCAGGCGCAGGCGCTCATGCGCGGTGCTGATAAAGAG
GAGATGGAGCAAACCGTTGTGGCTGATTGCGACGCACGGCTGAAGCACTGTGTCGAACAGCTACGAGTGGTTGCAGCACG
GCATACTGTCGGCAGTGGTGCCAGCAAAGACGATGCACCGACGTCACCAAGCTTCGGGCCCGAGCCCGCCGTTGGCGGGG
GCATGTTTGACAGCCAGGGCATGAACGACCTGTCTGTCTTGACAGATGCCAACATGCCGATCGGCGGGGACGGTTGGGCT
TGGGAAGACCTGGTAAGTCGCGACTCAAAGTTCGGCCACTGCGCTAGGACGCTTACTAATAAAGAGGTGCAGATGCAGAA
CCAGGATTTCACCTTCAAGTTCAACACAGGCAGCGTGGATCCTTTCTTTCCCGTAATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62