GenePrediction:GLEAN_2688 Details

Name: GLEAN_2688
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2644001..2645041 (+ strand)
Length: 1041
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2644001..2644270 (+ strand)
Length: 270
Type: CDS
Source: GLEAN
Position: GCSC_140:2644352..2644600 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_140:2644673..2645041 (+ strand)
Length: 369
>GLEAN_2688 class=GenePrediction position=GCSC_140:2644001..2645041 (+ strand)
ATGCTATCCCGCCTCCTTACAGCAAGCCTTTTGGCTGCGCTGTTTAAGGCAATTTTCGCCTACTCTAACCCGGGTGCTTG
CTCTGGCAACTGCTGGGCCCATGATCCGGCGCTGATTGTTCGCGCCTCTGATGGCGTCTACTTTCGTTTTAACACTGGCT
CCGAGATTGGCATTCTGAAGGCTGATAGCCTTGAAGGCCCTTGGGAAACTGAGGGTAGTGCACTTCCTGGAGGGAGCACT
ATAAACCTCCCTGGTAATACTGATTTGTGGGTAAGTTAAACATTTTCTGTGAGAAAACAGATTGTAAAGACAGAACAAAG
TTTAACTCGATCTATGATATAAATATAACAGGCTCCGGAAGTCCACTTTATTGACAACACATACTATATGTACTATGCTG
TATCGACCTTTGGCTCCCAAAACTCTGACATTGGATATGCTACCTCGGCCACAATGGAAGTCGGCTCATGGACCGATCAT
GGTAGTACCGGTGTTAGGTCGTCTTCCGGCAGCCCCTATAACGCAATCGACCCTAACCTGATCGAGGCCGGTTCATCCTA
CCTTATGAACTTTGGTTCATTTTGGGGCGACATTTATCAGGTCCGTTTCTTTACCTTTTCTATATCTTTAAGCGATATAC
TTCATATATACTGATAAAGTATTTCAAAACAGGTTGCTATGCTCAATCCTACTACAGCATCTTCTGATGCTCCCTATCAA
ATAGCATACAACGCATCTGGGTCGCACGCTGCCGAAGGGTCGTTTATGTATTATTACTCAGGCTACTACTACCTTTTCTG
GAGCGCGGGAACCTGTTGTGGCTTTGACACTAACAAGCCGGCCCCGGGTGACGAATATGCTATTAAGGTGTGCCGCAGTA
CCTCTGCTACTGGTAATTTCGTCGACCAAGCCGGGACGAGCTGTACAGCTGGTGGCGGTACCACTGTGCTTTCCAGCCAC
GACTATGTTTATGGTCCTGGTGGACAGGGTGTCTTTGATGACCCTACGCGTGGCACTGTGATCTATTATCATTATGGTTA
G

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62