GenePrediction:GLEAN_2689 Details

Name: GLEAN_2689
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2650068..2653462 (+ strand)
Length: 3395
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2650068..2651434 (+ strand)
Length: 1367
Type: CDS
Source: GLEAN
Position: GCSC_140:2651499..2651670 (+ strand)
Length: 172
Type: CDS
Source: GLEAN
Position: GCSC_140:2651760..2652539 (+ strand)
Length: 780
Type: CDS
Source: GLEAN
Position: GCSC_140:2652608..2652686 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_140:2652748..2653058 (+ strand)
Length: 311
Type: CDS
Source: GLEAN
Position: GCSC_140:2653115..2653462 (+ strand)
Length: 348
>GLEAN_2689 class=GenePrediction position=GCSC_140:2650068..2653462 (+ strand)
ATGGATTCTCAGGTTGTCTTGGACGTCTCCAAAACCAGGCTGGGGGACTCCACTAAGGCCGGCATCGACGCCGTCTCCAC
AAAGACGCCCGAAGTAGATCAGAAGACTACGGACTACGCCGATGCGACCGTTAAGAAGGCGGCCAGGGATAAGTCGGCCG
AATCCCCGGAAAAACACAGAAAACCCCATAAGACAAAGCAATCTGCCAACCATGTCGTCGAGGAGGAGTCATCCGATTCT
GACAGCGATACAACTTCGTCTACGGACTTGTCCCCAGATAATACGGACGGTTTTGATTCGTCTAGTTCTGAAGAGAAACC
AAAGAAGAAATCCAAGTCGAAGCTGCGACATGGCTCTAATAAAAAAAAGGAAAAGCCTGTCAAAGCAAAGCGGTCGAAGA
AACTCATCACGATTCCGAAGACCTCTAGTTCTGAATCCGATTCCGACCCCGAGTCTTCTGATTCAGATTTGAGTGTTGCC
GGCTCATCAAACTCTGACAGCAAGGAAAATACCAGGGGCTCGAGGAAGAATCACAAAAAACGTCAGCTGCATCTTCTGAC
CCAGCAACAGCAACAGCAAGACCTCACGAGACTCCTTCTCCTGCAGCAGCAGCAGCAGCAGCAACAGCAGCTCCCACCCC
CGATACAGCTGTATGATCCATATCAGCAATACGCGACTCCAGCGTATTACGGGGCTCCTTTTGGGAACCAGGCCTCAAAT
CCCCTCGGGGTCCACTTGGGCCTCACTTCCAATTACGCACAGCCACCACATCTGGGGAGCCCTCTCGGCGGATACGATCG
TGGCTTGGGAATTAGGCCACCTCCACCAGGTACCAACAATGGTCTTCGACGTGGCCGACTGCATGACCTGACAGGCATCA
TACCAGACAATCAGCGGAAGTCGTCCAGACATAGGCGATCCAAGACATCACGCCTTGATTTCAAGCGTGTTGACCAGGTT
TGGGATAGTACTATTCACAACTACAAGCTGCAAGACACTGCTGAGGGGATCACGGACCCGGAGTACGAAGGATACTTGTT
CCATGTGCGACGCACATTTGACTGGGAAGGAAAATACAAGCAGACTGTCGTCGACATTAAAAGCAAGCTGCTTCGTGACA
GCCTCCAGGAGGTGATAGGCGACGTCAAGGGTGTCAGCTTGGTGGAGGAGGTACCAAAGTTAGATCCCAATCTGCTTTTC
TTATACCTGGAGGATATGCGCAAGCATATAAAGGTTTTCAAGAATACAAAGCCAAATGGAAAGAAGAAGGTTGCCAAGAA
GGAGCGGAGGACGCTTGAGAAGAAGACACAGCAAATGAAAGTTCTTGTCAAGTATCTTGAAAGGGACTATGAGTCCGTGA
AGAAGAGGTAAGAGACCAGTTGCCTAGTGATCTGCGTCCATCTTCAGATCCACGGTTGCTGACTTTCTTAGTCTTCATCC
ACTTCTGGAAAATGGCTTGATCACATTTGACTTTCTGTGGGCTCTTTGGAAGCCAAATACCCTTGCTTATGCAACTACAT
ATGGCTCAACCGACGAGCCTCGCGTGTTCAAGGTTGAGATGGCTGAAAAGCATTTCAGCGTCATGAAGGGCGACTTTTAC
TACGTCGAAGGAAAGGCAGGTTTATCGATCTGTTCGAAATAACGTGTGTTCCTTCTGTAAGATCTTTTGCTGACAACTCG
GACATCCTACAGTACTTTGAATACGACGGTAAGCGCTTCGGCTTTGGAAGCATGGCAGACGAAATTGGCGAGTTCCGCGG
TGCCCGCAAAATCACAAGCTTGCCGGTGTATCCTTTACAGTACCACAAGAATGAGAAAGAGCTTCGCGAAAGACTTATTA
CTCGTGGCAAGAAATTTGTGGCGCTGAGTGGCGTTCAGTACAAGAGCTATGAAGGCATGGCGTACTACAAGAAGAAGAAA
GCAGCTGTCAAGGTCAACATCACCGGACGTATCATGATCGATCCCAGCATTCATCGACGGATCAATCCGAATTACCCCAT
CTCGATGGTTCGGCCCAGCGACCATGACCTGGCGTCCGGTGACGAAGATTCCAGCAGTGAACTGGATGACGGATGCGGTT
GTGGCTCCAAATCAGAGTCGGACTCTGGCCGAGAGCAACGTCACCTCGAGATCTTCCGAGATGAAAAAGGCAACACCATC
TTGGCCAAGTCTGTGGCAGATGACAGCAACGAAGAAGCAAAAGCGGACGAAATTGGGCCGGATAAGAAGAGCAATACGGC
TAGGCCGAGTAGCGGAAGCAGTACTGCAGACGACACCGACGAGAAGGCTGAGAAGGCCCCTCCTGAATTTGGCGACGAGG
AGTACTTGCTGGCCTCGTCGGTTATATTGGGCTTTGCATTTGCCGAGAAACTCTGGCTTGAATTTACGGTGTCGAACGTC
AAGGAGATCCAGTGGAACGATACTGCGTATGATTCACTGGTTCTAGAGCCGAAAACAAAAGATATTGTCAAGGTCAGCCT
TTCTTTTTTTTTCCTTTTTATCCAGCTTCTCCTCTCTCTAACTCCAAATGTCTGGTGTAGGCACTTGTTGAGTCGCATAA
ATACCATGCAGCAGAAAGCATCGACGACGTGATTCAGGGCAAGGGCAAAGGCCTTGTTGGTGCGTCTCCCTCCACGTCCT
GTCTCCTGAGCATGGATGGAATACTAACATCAGATTGTAGCCGTGCTCCATGGACCACCAGGAACAGGCAAAACACTCAC
GGCAGAGGGCATTTCTGAGCTGCTTAAGTGTCCCTTGTACATGGTGTCTGCAGGTGAGCTGGGCACTGACTCCCGATTTC
TCGAAACGGAGCTGCAAAAGATACTTGACATTTGCCACGCGTGGGGTGCAATTTTGCTACTTGACGAAGCCGACGTCTTC
CTTGAAAAGCGCAACATGCACGACATCCACCGAAATGCGTTGGTCAGCATCTTTCTCCGTCAACTAGAGTACTTTCAGGG
CATATTGTTCCTGACGACGAACCGTGTCGAGGTATGTGTGCTATTCCAGGAGATTTAAAGCACCGGTATGATAGCTAACA
CATTAAGACGTTTGACGACGCGTTTCAGTCACGGATACATATTGCGTTGCGCTACGGTAGCCTAGACAATCGTGCAAGGA
AGGCCATCTTAAAGATCTTCATCGAACGGGTCCGCGTGCTGGAAAAGATCGATCTGATGCCGTTCACTGAAGAAGACTTT
ACTGCTCTGGCGCGGTATGAATTGAACGGGCGACAGATCAAGAACACGGTGCGCACAGCACAGGCGTTGGCTGTGAACAA
ACGGGAGCCTTTGTCGATGAGTCACATCCGGCAGGTTCTTGAGGTGCAGATGTCGTTTGATCGAGACTTGAAGGGTGGGC
CTGGATTCCAGGATGCTATGCGCAGTTATTTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62