GenePrediction:GLEAN_2690 Details

Name: GLEAN_2690
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2658468..2660353 (+ strand)
Length: 1886
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2658468..2658923 (+ strand)
Length: 456
Type: CDS
Source: GLEAN
Position: GCSC_140:2658977..2659172 (+ strand)
Length: 196
Type: CDS
Source: GLEAN
Position: GCSC_140:2659242..2659382 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_140:2659548..2660353 (+ strand)
Length: 806
>GLEAN_2690 class=GenePrediction position=GCSC_140:2658468..2660353 (+ strand)
ATGGACGACGCCAAGAAATTAGCATCCTGGAAGGAGTCCTGGAAGGATTGGGTTAACAACAGCGCGCATAGCCAAGAAGC
CAAAAGAATTCTGAAAGAGACAGGACCACGAGTTATAATGGAAGGGGTATCTGATTTTGTCGCCCAGGAATTCCAAGCCA
TGAAAGGGACAAAGGGAGCAAGAAATGGGACTGACGTCCAAGAAAGCTTGAATTCCATGACATTAGAAGAACTTCGCGAA
CACGTCAAGGGTGACATTCCCAGGCTTGACGGGGGCGTTGAGCAGTGGAAAGCCAACAGACAGCACGGCGCAAAAAAGAT
CAGCAAAAAAGTAGTGGAATTTGTCGATGACTTTGATTCTTTTCTCGCCGGCTTCTCTGGCATTGTCGAGGTTGTGAAAC
TGGTTGACAATCAGTACGGCGGAACTGCGTCTGCTGTGCTGTTTATTATGTTCGCTGTATGTTCATTCCATCCTACACAT
ACGAGACAGACAGGAAATTGACCAACCAGACTGTCAAAGCCAAGGCTTTGAACGACAAGGCCATCCTCTCTTCCATGAAG
CTGTTGGCACATCGGCTGCCAGACCTAGACATTTATTACCAGGTCTATGCGGACGATATTCTAGCCAAGATGCTGTCCAA
GGCATACGTCGACGTCATTTTGTTTGCGCAAAAGGCCACCAACTACTTTCAAGGACGAGGACTAGGTGGGCGGTTCCAGC
GAATTATATCATTTGGTTAACAGGATCAACTAACAAGTCGCTCTCACATTGTAGGTCGCGTTGTCAAGGGTTTTACCCAG
CCCACTGTATATGCCGATTTGGAACAAAGCATGCTGCGAAATTTCCAGGACATTCGCTACCGATGCAATGCTCTGGTCTC
GCAAAGAATTTCTGAGCTATCCCAGAGTAACACAAGTGAGTATGGGAGATAACTGCGAGTAAAGATGCCAAAAAGAAACA
TAAAGCATTAACATCCTAACAGAGTTGTCCGCACGAGTTCAAGATCTTGAAGAAACGATCAAGAGTATGCTTCATCTAAT
CCAGGCAGCCTCCCACCTTGTCTTGCTGACTCCAGTCTAGACATAAATGACGAGAATGAATCTCGCAAACTCCGCAAAAA
GCTGCTCCGCAGTGGCCACTCGGAACCCTTGCCCAAGTCCACCCGGAACACACAGTTGGATAATCATGCCAGACTACTAG
CACACAATTTTGATCAGTATAGGAACATGTTTACCACCATGACCGTTGCCAAGCTCCAGAGCACCCCGGAATATCGTGAC
TGGTCCGCGGCCCAATCTTCCATGCTTATCCTCTATGGCAACAACAACACGGAATGCACCCACCCACCCCAGTCGTGGCT
CTCCCTAGTAGGAGTAGAATACACACAGCAACTCATCCGCCAGAGTGTCGACAGTGCCATCACAGGTGCCAAAACGAACG
ATTTGGACAATTTCATCGTCGCCCACGTCGTTGGTCAACGCGGTGACAAGCACATCGGCGCGGAGGAAGCCCTCGAAGCC
ATTGCGGATCAAATTATTGAGCAGCAACGGTGCGTCCTGCGCCGCAGGAGCGCTGCCGACCACATCACCTTTCTGGCGGA
CAGCCCAACCCTGGAAGGCCGAGCGCAGCTGCTACTGGCTATTCTCGACCAGTGCCCGCCACGGCCAGTCTTTGTCTTAA
TTGACCGACTGGACCTGTGCGCTGAGGATAAGACGTCGCGAGTTATCACGCTGCTGATGAACCTAGTACAGCTGGCGAAG
GGTCGTCTGAAGATTCTGCTAGTGTTCCGAAAGGAAGTGTGGGACGTGGACAGCCGAAGGGACTTGATAGAGAAGGAATG
GCTAGTGTCGAAGAAACTAGTGCTACTACGGCGAGACCAGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62