GenePrediction:GLEAN_2691 Details

Name: GLEAN_2691
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2661891..2668152 (+ strand)
Length: 6262
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2661891..2663812 (+ strand)
Length: 1922
Type: CDS
Source: GLEAN
Position: GCSC_140:2663888..2664238 (+ strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_140:2664299..2664916 (+ strand)
Length: 618
Type: CDS
Source: GLEAN
Position: GCSC_140:2664992..2666174 (+ strand)
Length: 1183
Type: CDS
Source: GLEAN
Position: GCSC_140:2666262..2666416 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_140:2667195..2668152 (+ strand)
Length: 958
>GLEAN_2691 class=GenePrediction position=GCSC_140:2661891..2668152 (+ strand)
ATGGCCAATGGCTCTACTAAAGAAACGACTTCTCACTTCCGCATCGCCACTCGTCGGGTGACCAACCTAGCCAAGAACGA
AAATCGGTCTTACTCAGATAAAGATATTTCTGAGAGTCGGTATGCGACGTCTGAGGTGGTCGTCGCGTTTCCAATGACCG
ATTCTGGTGTCCCCATTGTCAAGCCCCTGGATTTGTTCGTCTTTCTACCGGTGCGGCATGTGGGCTTCAACTTCCTTATC
CAAGCCGACTTTGTCACTGATGCCAGCCGGCAAGACGTGGTGGCCGATTCTCCTCGAAACATCGGTCTAATCGACGGCAT
CGCCAAAGCTTTTGTCCAAGGCATCGTGCAGATGAGTGGCTCCTCTGATACAAGCAGCTCCGTTTACCAGTGGATGCGAT
ATCTTCCGCAAGAAGCTGGGCAGAACCGGGACAACCTGTGGTGCACATTGGTGGAGAGGATTTCTGTCGAACTAAACGAA
GCGGCCGTGCTCCTCGGCCGAAAGCAACCGGAAAGACGGCCGATCCGTGACCTTTTGCGCCCTACGGGAGATTATCTTGA
TGATGCCGGAGAGCCGTTATTTGATGATAGCCACCCTGAAAAATTCATTTCTCGCAAGTATCAAACAAGTGACCTCGGCA
TACTCAAGGAGTACGGCCTGAGATATGCATATGCTGAAGATATCCTCGGTTTTATTGAGGAGGACCTTCGTCGCGGGCTG
GCCGGCCGGATGCAATCACCCACAACCACAGAGAGATGGCATACCCTCGCTGCAAAGTTCTTAAGTCATATTTGCGTTGG
GAAAATACGAACGAAAATGCTCACAATGAAGCTGCTGCCCTTGCATGATGGCACCTGGGCTCAGCCAGTGGCCAAAACTC
CCAGATCGATCTACTTCGCACAAACTGGCGGGCTGGACATACCTCCTGATATTGGTATTCGCTTGATTTCGCCGGATGTG
ACAAGTCCAGAGCGCAAAGCCCTCTTCCGACTCCTGGGTGTCGAGGAAGTGCCTATTCCATTCGTAACGACCATGATCAT
CAAAAAGTATATCGAAAGAACCGGAGAACATGCGATCTCCCTTGCCAGCTCCAAACGGCATCTTCAGTTCCTATATTTAA
CAGACCACGTGGGGTTTTCTGACGGAGACGACTGGGATACAGTGAGAGTCGTAAATCAAGATGGAGGTTTAGAGAGTGGA
ATAGACGTCTACAAGCACAACAGGGATCCCTACGGCGCCACGGAACTCTTCAAAAGGACTGTATCTGGGCCAAAACCGGG
TGATGGCGCTCCAGGCTACGAGGACTGCTCGTTTATCAACGAGAAATACTTTGAAGAGAGCCCATCCACACCACAGGGAC
AGGACCTTTCATGGCTAAATTGGCTTTATTATTGCTCATTTGCCGAGAGCTATGTCAGACTTGTTCACTTGGGGAAACTT
CTGCTTCCTGGGCTTTACGTTCACAAACATCGTCCGGAGAAATTTCTCGGCGCGCTCAAAGTCAACTACGAGAATATCGA
TGAGTTCAGAATTGATACAATTGGCCTCCTTCAGAGGACGACCGTCCTGTGTCAAGGCTCCGGCTACGCCGAACTTCAAG
ACGCCTACTATCCCACAACGGAACTGCTGAAGCGTGTTGGCAAGCTCGTGGAGCCTGGCGCCTTCTTTCCCTGGCTCTAT
CTAGAGAACACCACCGGGACTGATGATGCTGTGCCGACCGATTGGAAGGATTTTCTCACGGCCTTGAAGATCACCGCTCC
TACAGACCTTGATTTTGCCCTGGCCATGCTGCGATACTCACGAGCTGGCTTCCCCCCAGAAGCCACGTCTTCCAGCAGAT
CAAGGCTCTTTGACCTATACGAACACATTGTCATAAAACAGAGCGAGGCGTCGGAAGACCCGGAAGCAGCGACAAAGGTC
CAGTAAGCTATACGCATGTTCATAGTGATTTCACCATTATGTACAGTCGCGGAATCTAACATATCGTTTCTCTACAGAAC
CTTGTTCGAGAAGCAAAGGTGCATCTACATCCCAACCGATGCAGGGGGGCACACCTGGGCATTTCCCCATGAGTGTGTCT
GGAATGCGCCGCAGATGCTGCAGACAAAGCATGTCCTACGCCTGCTTTACGAGCCCTGCCATAGGGAAGACAAGAGGGAC
GATGATATACTAGCGATTCTCTTCAAAACCACGCTAGGTATTGATGACTGTAAGTGGAAGACCCTTATCGAAGAGCTCAA
GGGTCTCAAGGAGGCGGAATGCAACGACATTGCCACCCTCTTGCCGATCTACAAGGCTCTGAATGCACGGCGGAAAAATT
TGCCTCACAAACATCAAGAAGCCATCAGGTACGTCTTCATGGTCGATTTCAGATAGGAGAACAGAACAGTGGGAACTTAC
ATTCCTAGGCTGGCTTTTGAAAACGACGCCCTCATATGCGCACCATCCGACGATCAGAATCCCTGGCGCAATATCGCGCA
GTGCATCTGGTCGACCGGGGCCAAGCTGCGCGGGCGAGCCTCTTTCAACCACCACTACGAGAGCCTCAAGGATTTTTTCG
TTGAGTTTTTAGGCGTGAAACTGGTGGACCTGGAAATGGCTATTTCAGAGCTTAAATATGCGGGTGGCGAAGCGAAAACG
TCGGTGGATGCTTTGAAGGAGTCCATCTGGATGGTCAACTCTCTGCTATTGTCTACACAACGACCCCCGAGCTCAGAGGA
CGTGGTCGGCGCCGACATCTTCCCCATCAAGATGCCCAATGGACAGACCACGCGCGGGTCGGCAACTATGGAGTTTTGTA
TCGTGGATCGCGAGTCGCTGGGCCAAGCATTTTCAGAAAAGGTGAAGCTGCTGGACTTTGGACTACAGGAAGTATCTCGT
CTGAATCCGTTTCTCCATTGGGCGCAGCTGCAGGACAGATTCATGTCCAAGTCCGTCAGGGAGTTCACTTCTTTTCATGG
TGACGAGGCCAGATTGGTGTCGAAGACGGACCGCCAAATCAGTCACCGAGCCTATGCCCTTCTCAGGTGAGTGTCAGATG
CCTTTTTCAGTAAATTTCTGCATACGTACTAAGTGTGTGAAAGAATTGCTTGCCACTTCAGGAGTCCTCGTACAGAAACG
AAGGAGGGCGTGCACTCCCTGTACGATATGCTCAAGGGTGCCGAAGTATACGAAACAAGCGGCATTTCATCCGACCTCAA
ACTCACCCAAGACGACACAGACCACGTGGTCGTTGGTGACATTGCAACCCTCCACATCGACGAAGCGCCGACCGGTCTTC
TCAAGGTTTACCTGCCACGGGACAAAGACGACCAGACATTTGTCTTTGTCACAACGCTTGGCGGGAAGCTTTTTGAATGG
ATGATGCGGCAGCCCAGCGAGAAGATCTCTTTCGGACTTGAAAGGGGGACCAAGACCATCCAAGAGGTCTTGATGGCTCC
TCGCTCGAGAACAGATGTGGTCCTCGAGAAGAACGGCATCGCGTGTATCCACGATGTTGAAGACACCGATGAGCAGGTCG
ACTCCGAGTCCGAATCGGCTACATCCACACCACAGCTACGAGCAGCCGAAGCAGCAGCGCACCTCATCGGCGAGGGGGCT
GGATTGGAAGACAGCGATGTCGATGACCTCTGGACGCCGTCTCGCAGCACCTGCGACGACAACGACAACGATAACAACGA
AGATCCAGAGCTGCACCAGTCTTTTCGTTCTTCCACGCCGCCCGGTGGACGGCGCCCTTTCGGTAATCTCTCCATCGCGG
CCCCGGCCACTCTTCAGTCTGGCATAGCGACAAGAGCTAGTAACACTGCCTACACCGCTCTCCTGGAACGGGTGATCAAT
ACCGCTCAAAACAAGACCATTCCGAGCAACAGGTCGTTCGGCATGAGTCATCTGCTCGCCAGCATTCCTGCGGGCAGCGA
TGCGATGCTGAAATTTGACCTCCAAATAGCCAGCGCTTCTGAGCGTGATTGCCGCGTGGACGCAGCCGGTGAGCTGTATG
TCTTTGAGCTTCTGTCGGGTCTGCCGGAGAAGCTGCCCGGCTTTAGCCGCGACAGCTGGCAGAGCAATATACGCCACTAC
GTCACGTCGCATCCCAAGTACGCCGATATGGCGTCGTGGTCGGGGTGGGAGATGTCCGACATCACCTACTGTGACACTGC
TGGTGTGTTGACCCGCTTGCTGATTCAACAGGGCTACCTGGATGGAGACTCGTGGTCCGGCGAGAGGCCGCAGTACTTTA
TCGAGGTCAAGACGACTACGTCCCGCTGCGACATGCCGTTCTTCGTAAGCAAGGCGCGGTACAATAGAGTGAGCGGTCCT
CCGCTTGCTTGGTAATATGCAACTACGCTACACGGCTAACGAGACCTGCAGATGCAAGTTATGACGCTCAAGCCAAATAA
ACGAGGCGCGATCTATGTCATTTTCCGCGTGTACAACCTGGGGCAGGCCGACATGGGCCTCGCGGTGTATGTGGACCCAG
AAGCCTTGCGAATGGCGAACCAGTTGGAATTTATCGGCGAGACTTGGTTAGTTGTGCCGCGGCAGAGGACCTGGTAGTGG
AGTAAAAATGGACAGAAGATGAAACGGGTTTCGGGTTTTCTCAGTATAGTATATATCGTACCTTTTATTATTATAGGTAG
GTGCCTTATTGTCCCGTTCATAGCCACGATCGGCCATTTCGAAACCACAATTTAGTAAATCTTGTCCAGAAGCCACGGTA
TCGAGTCCGGACTAAAACGAGATCACGTACAAAGGCTGAACGGTTTATCAAGAACCTCCAAGGAGAGTAAGGGAGCAAAT
TGACTGCAGACTGTCTCTTGTCTGCAATAGCATATTAAGGGTCTTCACTGTTGTGATACGGAGTATATATATGCGGATTG
TATTGACCGCTGGTCTATTGTTACGCTAATGTAATATCCACTTAGGTTATTACTGCATTAGGCTTTCCGAAGGAAGACAC
CAATATGTATCAAATTATGGGTGCCCAGTGAGCGTGAATGTATTGTTATTGTTAGGTACTCCCGAGGTATGCCGACGTGC
GTCAAAACACGTACTAATAGCCCCATGCGCCACACAGTACATGTATTCTTTCATCACACTGCCTAATCGTGCACGCCCCT
CCTATTCTGGTCTGGTCCATTCGACAATATGTATTGCAGTACTATTTTTGGGACATTTGGAGTTATTTGTGTTAGTGGCG
GAGGGGTATTTTGCCCCACCTCGGAAGGTTAGAACTTGGATAATGCCGCTTTTGCGGGAAAGCCATTGCTAGTTGTCATT
GCAACTGCGAGCCCAACAAATCAGTCACAATCAGCACGTTATCATGTCTTCACGGCCTATCTGCAACGTCGATACCCCGG
ATCCGTGGATGGTGGCTGCCAATGGCGGCTTTTTCTTCACGTTTACGCTGGGTAACCGGGTTGAGATCTGGTTTTCACAA
TCGATGGAGGATTTCCACCACTGTCGCAAAACCGTTGTATGGCAGCCAGCTGCCGGGTCGCCATGGTCTGCTGATATCTG
GGCACCCGAACTTCACTATCTCAACGGCGCCTGGTACATCTACACGTGTGCGGCGCCGCCGGGCGTCGGAAACGCGGGAC
ACCGCACGGTACTGTTGCGGACATGGTCACCGGATCCCATGGATGCTTCCGGATGGCAATTCCTAGGCCCAATTCCGGGC
ATGCCTGACCATTGGGCTATTGATGCCACGGTGTTCAGTCCAGACGGCCGAGAGCTGTACTGCTGCTGGTCGGGATGGCC
ACCCGGCGACCATTCCGACACGGAACAAGACCTGTTTCTGATCAAGATGCGGCGACCCGAAGAAGCCATCGAAGGTAGTG
AGGTGTGCATATCCCATGCACAGCATCCATGGGAACGGCCAGACGGCGGGCGACGAGGCGTCAACGAGGGGCCAACGTGG
GTCGACTCGCCGGCCTTCAGGGGCATTGTCTACTCGGCCCATGGCAGCTGGACGAGCGAGTATAAACTGGCACTGCTTGC
GTTTGTGGGCGGTGATCCTTTGCGCGCAGAACACTGGGTCAAACGTTCAAAGCCCCTTCTTGTCAGCGGTCCTGCCGGAA
GAGGCCCTTTCGGCCCAGGACATGCGAGTTTTATCCGGAGCCCTCACCAAGGCGATCCGCGACTGTTCTGCATCTATCAT
GCGACAGAGAAGGAGGGAGAGGGATGGAATAACCGCAAAGCAAGAGTGTGCTGTCTAGGGCCAGAGTGCTTCTCACACGA
TGCACATGTTATAGCGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62