GenePrediction:GLEAN_2693 Details

Name: GLEAN_2693
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2671299..2673419 (+ strand)
Length: 2121
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2671299..2672561 (+ strand)
Length: 1263
Type: CDS
Source: GLEAN
Position: GCSC_140:2672661..2673419 (+ strand)
Length: 759
>GLEAN_2693 class=GenePrediction position=GCSC_140:2671299..2673419 (+ strand)
ATGGAGAAGTTGGCGCCAGACTCGTCGGCCTTTCCGCCACCATTGCCTCCATGGGCACAACTGCGCCATGGCCGACTGCG
ATCGACCGGCAAACGACGTCTTGCGCGCTTTGCAGCAGGCGTCCTGGGTCTCTTCGCGGTGCGCCACCTGACGAGAAACG
GCCTCACCTTTCTAGATATTGGCTCGGAGCACTGCAGTGATACCAAAGAGACATTTCCCTATGGACGCTTCCCGCAAGCA
GACGATCCTTTCCGCTTCCAACCGTGCACCAACCGGACGCGGCCACCAGCGCTAGACGATGGCGAGCCGGACAAGAGCTG
GGCCGGGCTCTACGAACCGGACCCGTCGCACTGGAGCTGGGGCAACCGGACGGAAAGCGATAATGACAGCAGCAACCTGG
ATCCGTATGCCGGCCGGGGCATCTATCTGTGCGGCTATCTGGACGTACCACTGGACTGGACGAACGCGACGGACAGCCGG
ATCACGCGCCTGGCCGTGACCAAGTTCCAGGTGTCGGGGCTGGCGCGGGCAGCTGATGGCTCGGGCACGAGCAGCGACCG
CGGCGGGCGCAGCGAGCGGACGATTGTGGTGGAGCCGGGCGGACCGGGTGGCAGCGGGACGGGGTACGTGTGGCGGATGG
GTGAGCGGCTGTCGGCGCGACTGTCCGGTGGTCAGCTCGACGTGCTCGGCTGGGATCCGCGAGGGGTCAACGCGACGCAG
CCGGCGGCGGCTTGCTTTCCATACGACGCGGACCGGGACCGGTGGTGGCAGCTGACGCACCGATACCGGGAGGTGGCTGG
CAAAGAGACGGCCGGACAGCTGGCCGTGGCCGACGCCATGTACGCGGCGACGATGCGGGCTTGCCGGCAGACACTCGGCG
ACCTCGGCCGGTTTGTGGGGACGGCGATGGTGGCACGTGACCTGGACGCCGTGCGCGCCGCACTGGCCGAACCCCAGCTG
ACCGGCTACCTCGTCAGCTATGGCACTGGCATTGGGCAGACGTACGCGAACCTGTTTCCGCACCGCGTCGGCCGCGTCAT
CCTAGACGGCACCGAGTTCGTGCCCGACGAATGGCAGCTCGGTGGCTTCGGCTGGGCCTCGCTCGACAATGTGACCCATG
CTTGGCGCGACGGCTTCCTCGGCGAATGTCTCGCTGCCGGACCTCAACACTGCGCTCTCGCTCGGCCAGGCCCTCGCAGC
GTCGGCAGCTTCCCGCCTACGGTCGACGCTCTTGAACACCGTATGGCTCGCCTCTTTGACGATGTGCTCGCCCGTCCCGC
CGTCGCCACTACCGCCACCGCTGGTCCCGCCATCATCACCTACTCCGCCCTCGTTGCCGCTGTTTATAGCGCCCTCTATC
AGCCACGCACCTGGCCACACGTCGCCCAAATGCTCTTCGACCTCGAGTACGGCAACGCTACTATCGCTGCCGCCCTTACC
GACAACTTCGTCTGGCAGTACGACCCCAGCGTCCCCGCCTCCGGTCCCGAAACTTGTCCGACGGTGCCTGGCTCGGCCCC
GGCTTCGGTCCCGGTCTCGGCCCCGAGCTCCGACGAGCTCGGCATGCTTGTCATCTGCGCCGACGCCTTTGACGCCCCCC
AGCCCCCAGACGGCGTCCGCTGGTGGGACCGCCTCTGGGCCAACATGACCCAGACCTCCTGGATCTCTGGCAACTCGCGC
TTCTACAACGTCCTGCCCTGTCGCCACTACTCTGACCACTGGCCTAAGCCCGCCGGCGTCTACCGAGGCCCCCTCAACCG
CACCCTCGCCAATCCGGTCTTGCTTGTCGCCGAGACCTACGACCCTGCTACTCCCTTGCGCAATGGCCGCCGATTGGCCG
CCGCCATGGGCCACCCAAACGCTCGCCTCGTCGTCCACCACGGCTACGGCCACTCGTCCAACGCTGACCCCTCCGACTGC
ACTGACACTGTCTTGCGTGACCTCATCCTCCACGGCCGCATCCCCGAAGACTCCGAGACGCCCTGCTACGCCAATGAGAA
GCCCTATCTCTACGGCCTCGGCAAACAAGACTCGCCGTCCGAAGACCCCGTGGCCGTTTGGCAGGACCACATGCGCGAGA
TGATGCTGTGGAACCCAGGCCTCATGCGCCACGGCTCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62