GenePrediction:GLEAN_2694 Details

Name: GLEAN_2694
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2685381..2685711 (+ strand)
Length: 331
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2685381..2685482 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_140:2685519..2685562 (+ strand)
Length: 44
Type: CDS
Source: GLEAN
Position: GCSC_140:2685582..2685711 (+ strand)
Length: 130
>GLEAN_2694 class=GenePrediction position=GCSC_140:2685381..2685711 (+ strand)
ATGAACCTCGCCATTGACTCTGGCATCAATTACTGCGCCGAATGGTTTGGCAGTATTCTGACGACGACGTACTCGAAGTT
TCCGTCTGTTCTGGAAACTGCTGTAAGTACTCATTTTTCCATTTTCTCTTCTCCACAGACTCCCTCCATCCAGGACGGCC
AAACCTTTGCCGACGACCTCAGGTGCGATAATCTATTCCAGCTCTGGAAAATCACGCTCAAACACCACCGCCACCATCGT
CATCATCTCTATTGCCATTGTCTCGACCATGAGCACTGTCACGTCGCCGGGTCCAACTAAGGCCAAGTATGCGCCTAGAT
TGGATTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62