GenePrediction:GLEAN_2695 Details

Name: GLEAN_2695
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2687026..2688901 (+ strand)
Length: 1876
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2687026..2687455 (+ strand)
Length: 430
Type: CDS
Source: GLEAN
Position: GCSC_140:2687508..2688006 (+ strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_140:2688063..2688182 (+ strand)
Length: 120
Type: CDS
Source: GLEAN
Position: GCSC_140:2688241..2688901 (+ strand)
Length: 661
>GLEAN_2695 class=GenePrediction position=GCSC_140:2687026..2688901 (+ strand)
ATGTCGACCACCCTGGCCAAGGAAAAGGGAGGAGCCTTCAGCACGGTCGCCCACTCGAGCTCGCTGGACTCGGACGCCCA
GAGCTCTACGGGTGGCGTGCCCGAGCTCGGCGCGCCGGTGAACACGAAGCAATTTTGGTTCCAGAAGGCGCGCAACTACG
ATCCCAATGCGATTGCGACGCAGCGCAGCGTGTTTGACGATGCCGAGACAGCGGACAAGTACCAGCCGCGCACCGACTGG
GAGAATGTGCACCGGTTCGACCCGCTCTTCCGCTGGACCTGGGCCGAAGAGAACCGGCTGGTGCGCAAGATCGACGTGCG
CATCATGGTCTGGACCTGTGTCATGTTCATGGCCCTGGAACTCGACCGGGCCAACATCTCGCAGGCGTTGACGGACAACT
TTCTCAAGGACCTGAAGATGACGACCAACGGTGTGTGTTGATCTCCTTGTCCCTTCGGCTGTCCTTTGCTTCTGACCGAC
AGACTACAACCTCGGAAACACGGTGTTCAAGCTGGCCTTTCTGTGTGCCGAGCTGCCCTCGCAGCTGGTGTCCAAGTGGG
TAGGCCCCGACCGCTGGATCCCTGCGCAGATGACGATCTGGAGCATCGTGGCCTTTAGCCAGTTCTGGATCACCGGCCGC
TCCTCCTTCTTGGCCACGCGCGCGCTGCTTGGCATGCTGCAGGGCGGCTTCATCCCCGACGTGATCCTGTACCTGTCGTA
CTTTTACAAGCACTTTGAAATGTCCATCCGGCTCAGCTTTTTCTGGACGGCCATGAGCATCGCCGACATCATCTCGGCCC
TGCTCGCCTATGGCCTGCTACACATGCGCGGCGTCCAGGACAGATCTGGCTGGCGATGGATGTTTCTACTGGAAGGTCTG
CTGACCTTTGTCATCGGCCTTCTCGCCTTTGTTCTCATGCCCCCAGGTCCCTGCCAGACGGCCAGCTGGTTCCGCGGCCG
CAATGGCTGGTTCAACGAGAGGTATGGCTTGCCTCGTCGCTCTTCCGGTGCCTCCTGTTGCTGACAGGCTTCTGCAGAGA
ACAGAAGATCATTGTCAACCGTGTCATTCGTGACGACCCGACAAAGAGCTCCATGCACAACCGCGAGCCCATCACGCCGC
GGACGCTCTTCAAAAGCCTCAAGGACTACGATCTCTGGTAGGACAGCGCACTCTCCACTTTGCTGACTCATCCATCTGAC
AACACTTCTACCTAGGCCGCTGTACACTCTAGGCCTCGTCTTCCAGATCCCCATGACGCCTCCGACACAGTATCTGACAC
TGTCGCTGAAGGGACTTGGCTTCAACACGTTCCAGACCAACCTGCTGACGATACCGTACACCGTCGGACACATCATTCTG
ATGCTTCTGCTCACGTATCTGTCTGAGATCTGGAACGAGCTGACGCTGACGGCGATGATCGGCCAGTTCTGGGCGCTACC
TTTTCTCGTATGGCTGTACAAGGGCGCCACGGTCCAGACGAACAGGTGGACGGTCTATGCCATGACCACGGTGCTGCTGG
CGTATCCCAACGCGCACCCGATCCAGGTGGGCTGGAACTCGCGCAACTCCAACGCAGTCCGCCTGCGCACCGTCTCGGCT
GCGTCCTACAACATGTTTGTGCAGGCTGGCGCCATCATAGCATCTAACATCTATCGGAAAGACGACGCGCCGCTGTACAA
GCGCGGCGACAAGAATCTGGTCGCGATCACGTGCATGAACATTGTGCTCTACCTGCTCGCAAAGACGTACTACGTGTGGC
GGAACAGACAGCGGGCGGCTAGGTGGAACGCTATGTCGGAAGAACAGCGGCTACACTACCTGGCGACGACCAAGGACGAG
GGCAACAAGCGGCTAGACTTTCGGTTCCAGCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62