GenePrediction:GLEAN_2696 Details

Name: GLEAN_2696
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2693371..2695237 (+ strand)
Length: 1867
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2693371..2693501 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_140:2693969..2694312 (+ strand)
Length: 344
Type: CDS
Source: GLEAN
Position: GCSC_140:2694371..2694426 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_140:2694483..2694940 (+ strand)
Length: 458
Type: CDS
Source: GLEAN
Position: GCSC_140:2694997..2695237 (+ strand)
Length: 241
>GLEAN_2696 class=GenePrediction position=GCSC_140:2693371..2695237 (+ strand)
ATGGTCGACTGTCAGCGAATGGACTTTGGTTCGTATGAGGCCCCGTTTCCGGCTTCTGTCACGGCTCGCTCGCTCATGCT
CATACGAGCGCGCCAGATCTGGGAGCTGCGGGCTTCCCACAGGGGGTCGAGGTACGACAAGATCGGCACCACTTGCGCGC
AAAAGCCCAGTTTTGCTCGTAGTCCATAGCCGGCTAGCTGCCAGGGTCCGTCTGCTGATTACGAGCGAGAGCGCGCCTTC
TGGGCGGAGCCGTCCACCTTGGACACGCAGCCGACAGGGGGGCCGTCCTTATCTGTCTCGTCCTGCTCCCACTCTACATA
TGTACCATTCCGGATCAGCTCGTATTTCGTCTGCCATACGAGTATATATCCACTGACGGCTAGCCCGTGACGCCCGGACC
CTCGTCTCTGCTTCCCCCCCCCCCCTGTTCCACTTCCACTTCCATTCCCACGCCCGCTTGCCCTTCCTCTTCCGGCGTCT
GCGAGCGCCAAAAGGAAAACACCAAAAAATCTCGTATTAGGCTGGCGTTGGTCCGATCTCGAAAGCTGCTCCGTCACCCA
AGTCTGTCCGTTCTTCGAACATGCCTTCCGTCTGCCAGTAACGCACCCAGCATCGCCATGATCGTCACCCTCTTGCTGTC
GGTGCTCAACGCCGGCTTGCTGGCCATTCCCATTGGCGGCACGGCCGGCGTGCTTGCCGGCATCGACTACCATCGTCGCG
TCACCGGCCAGGCTCCTCTCTTTTCCAACCCGTCCGGAGGCGGCGGTGGCGGCTTCGATGGCGGCGACGGCGGCAACGGC
ACCGACGACAACAGCACCTATCCCGGCTGGGATGGCGACAAGCCCAACGCGACCGTCGTCATCGGCGGCACCACCATGTC
CGAATACTGCCAGCAGTACAACGAGATTGCCATCAACGCTACCGACGGCCAGAACTATACCGGTACGCAGCTCTTCTTCG
TCTCTCTTCTCGCTTCGTGATCTCCAGCTAACAGCCGCAGTCAATCCGAACCAGTGGGGTTGGGAACAGGCCAAGGGCGG
TGGCCTGTGTCTGAATGTGAGTCTGAGTCCTGTGATCCTGCAGTCTATCTCCCCTCCCTTCTGACTTTTCAGGTCACCAC
GTTCAACAATGATACGTATCCCACAAACACCACCGCACCCAAGTGGTCTGCTACCTGGCAGTACCCCGTTGGCGAGACCA
GCCAGCCTGTGCATGCCTACCCCAACATCATGATCCGAGGCGACGTCTTGCCCGCCAAGCTCGGCAGCCTGACTGAGCTC
GGCATCGACATGCATTGGACCTATACCGACAACAAGACCATCACCGTCACCAACACCAACTCTACCGTTACCACCCATAC
CAACTCCACCAAGCGTGCCGTCGTTTCCGTCGATTTCAGTGCCAATGTCGCCATCGACATGTTCTTCGACAAAAACGCCA
CCAAGTCGCAGCTCACCTCCGATGCCGACTACGAGGTCATGGTGTGGTTTGCCCAGTTTGGCAAATATGCTGATCCCATC
GGCTATTCCGACGGCATCGTCGCCTCCCAGATTGTCGATGGCGTCAATTTGTGAGTATCGCCCGTCTGCTCCTTTGCCCG
AGACACAGCACTGACAGGCCAATTAGCACGCTCTACAACGGCACAAACAGCAAGGACCAGCACGTCCTCACCTGGATCTC
CGAAAACGAGACGAACAAGTTCAACGGCAGCATCCATCCGCTGCTCACCTCACTTCCCAACCTGGGCCTAAAGTACGCGC
CGGCCAGCACTGACTACATTGGCTACTTCAGTTTCGGCTCAGAGGCGTACTACTCCGAGACCACCGTGATATTCAACGTG
CTGGGCTTGGAAATGAATGTGTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62