GenePrediction:GLEAN_2697 Details

Name: GLEAN_2697
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:2705941..2710457 (+ strand)
Length: 4517
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:2705941..2706023 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_140:2706086..2706197 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_140:2706480..2710457 (+ strand)
Length: 3978
>GLEAN_2697 class=GenePrediction position=GCSC_140:2705941..2710457 (+ strand)
ATGGCCCCCTCCGTGAAAGCCTGCAAAGAGCAGGTTGTTGACGAGCTGCCAAAGCGCTTCAAGCGCTTCAAATTTGGGAT
CCAGTGAGCTGCACCGAGTCATCGCTGCGCTCTGGCTGAACTTGGACTAACGTGCCGACTTCCAGATCAGGCCAAGACAT
TGTCAACCAAAGCGTCCTTGAAATATCAGACTCTATGCTGTACGATGTCGAGAACAACCGAGCACCGTATCCCCATGGGC
CTCTCGACTCTCGCTTGGTTCGTCTTTCGCCTCCCTCAAATCGCTGTCGCATCTTTAACACATTACTTCTTGTATCTAGG
GAACGTCTAGCAAGATTGGACAGTGTGCTACGTGTCTGATGCCTCTCAGCATGTGCCCTGGTCACTTTGGGCACGTCCGC
CTTCCGCTTCCTGTATTTCACATAGGATATCTAGGTTTTACTATCAAGATCCTACAAAACATATGCAAGGTTTGTTTGCT
TCACTTCCACCTATCTGATCTGCTGTTGTTTTACTGACTTAGCCTCTTGAACACTTCAGGACTGTGGGCGCGTCTTGCTG
ATGGAGTCCGATCGACGAACGTTTCTGAAGGAGCTCCGAAAACCGGGAATCGACAATCTTCGAAAAACACAGATATGCAA
GAAGGTCAACGAGATCTGCAAGAAGTGCAAGGAATGTCCATATTGCCAATCTCTGAACGGATCAATCAAGAAAATTGGCC
CTCTGAAGGTTGCCCACGACCGATTTGCAGCGTTCAACAAATCAACGGCAGCCAAGAAAATACCCCCAGCAAGAAAGAGG
GAATTTGAACATTCATTTTCGGAAGCCAGGAAGAGAATACCAGACTTGGAAAAGCATCTGCACCGAGCTCTTGAGGACCT
TGACCCTCTGCATGTGCTGAACCTTTTCAAGAAGATCAGTCCAAGTGACTGTGAACTTCTTGGTCTGGATCCCCTGGACG
GCCGACCGGAGATGTTCATTTGGCAGTATCTACCAGCGCCACCCGTCTGCATCCGCCCATCGGTTCAACAACAAAGCTCC
AGCACAGAAGACGACCTGACGACCAAGCTGGCCGAGATTGTTCAGGTTTGCGGGTTGATCCGCACTGCGCTGGTCAAAGG
TGCCCCTATCACTACTCTGATGGAGCAGTGGGAGTTCTTGCAATTTCAGCTGGCGATGTACATCAACAGCGAGCTTCCAG
GGCTTACTGCAGCCCGTCATGGCAAGCCCATCCGAGGATTCTCGCAGCGGCTCAAAGGAAAACAGGGTCGGTTTCGAGGA
AACTTGTCCGGCAAACGAGTCGACTTTTCTGGGCGCACAGTCATCTCGCCCGACCCCAATCTGGCTATCAACGAGGTTGC
TGTTCCGGTGCTTGTTGCAAAGAATCTGTCGTATCCCGAAAGAGTCAACCACATCAATATCCGAAAACTTCGGAATTTGG
TTCTTAATGGTCCGACACAATGGCCGGGAGCGAAGTCTATCCTGAAAAAGGATGATGGAGGATATAAGCTGGATCTGAAC
TTTGGAAACAAAGAACAATTTGCAAAGGATCTCCGGGTTGGGGACACGGTGGAGCGACATCTCGAGGATGGCGACATTGT
TCTCTTCAATCGCCAGCCGTCTCTTCACAAGCTCAGTATCATGTCGCATCTGGTCAAAGTCCGGCCTTGGAGGACATTCC
GGTTAAATGAGTGCGTGTGCGGGCCATACAATGCAGATTTCGATGGTGATGAGATGAATCTTCACGTCCCTCAAACTGAA
GAGGCCAGAGCTGAAGCACTGACTCTGATGGGAGTGAAGCACAATCTGGCAACTCCAAAAAACGGAGAGCCCATCATTGC
AGCCACGCAGGATTTTATCACGGCCGCCTATCTTATCAGCAGCAAGGATCGGTTCTTCACCCGGCACACCTTTGCCTACA
TGTGTGCGCACATGACTGGCTCGTCGGAGCAGCTTGATATACCGCCTCCTGCAATTCTAAAACCACAGGCACTCTGGACA
GGGAAACAGGTCTTCAATATAATGATGCGTCCGAACAAATCGTCCAAAGTGTTGGTCAACCTCGATGCTAAATGCAAGGC
TTACAAGAGACGTCCTGGTGAAGCCCCTGACATGGATCCAGAGGACAACTTTCTGGTGGTCCGCAATTCAGAGGTCATGT
GCGGGCGAATGGACAAATCAACTGTTGGCTCTGGAAAGAAGGATTCGGTGTTTTACGTCATCCTGCGTGACTACGGTCCA
GATGAGGCCGTCACGGCTATGAATCGACTCGCAAGGCTCTGTGCACGTTTCATGGGCAATTTCGGGTTATCAATCGGTGT
TTTTGACGTGTTTCCGCTCACTACCCTTCGAGAAAAGATCAAAATTCTTGTTCGGGAAGCCAATTTGAAATGTGATGAAC
TTATCCACAAGTTCAACACTGGCAAGCTAGAAAAGTCTGCAGGCTGTAACCTGGACCAAACATTGGAAAACTCGATTTCT
GGTGTTCTGAGCAAAGTTCGATCTGCGGCCGGTGACCTCTGTCTGGAGACGCTCAGCAAACACAACGCACCGCTTACCAT
GGCCACATCCGGATCCAAGGGTCTGGCCATTAACGTTGCGCAAATGGTGGCCGTCGTCGGACAGCAGATCATTGGTGGCC
AGCGTGTGCCCAATGGCTTCCAAGACCGGAGTCTCCCACATTTTCCCAAAAATGTGCGCAATCCGGCCTCGAAGGGTTTC
GTGCAGAACAGCTTCTACTCGGGTCTCCTGCCTACGGAGTTTCTGTTTCACGCAATCTCGGGTCGAGAGGGCCTGGTCGA
TACGGCCGTGAAGACGGCAGAGACGGGATACATGTCCAGAAGATTGATGAAATCACTGGAGGACTTGTCTACGCAGTACG
ACAACACGGTCCGGACATCTTCTGGCGATGTTGTGCAGTTTCAGTTTGGCTCTGACGGACTGGACCCGGTGGACATGGAA
GGATCTGCCGTGCCGGTCAATTTCGAGCGGAGTTGGACGCATGCAGAGAGCATCACTTGGAGCAATGCGGAGCCTTCGCT
AGATCCAGACACAATCATGGCCGTGTGCGACTCCCTACTGGCAGACGAGCGAGCCAAGTACATTCGGCGGCATCTGGTCA
CTGATGCGTTGTTGGATTACAACGACCAGTCGGATGCCAGTCTCGATCTGCAAGAGGGTGCTCGCAAGTTTCTCGACGAT
GTACGCCAGTTTGTGCAAAAACGTGCAGACAGACTCACCAATGCAAAAGAGCGTCTGGTCGAGACGTTCGATGCCTCACT
CGCATCGCACCGCTCCTATATCGACAAAACAGCAAAAGTGTCAGAAAAGACGCTGAGGGCGTTTGTGGTCATGTGCCTGG
ACAAATTCCGCAAAGCCCACGTCGAGCCTGGCCATGCAGTTGGTGCCGTTGGTGCGCAGTCTATCGGCGAGCCCGGAACG
CAGATGACGCTGAAGACGTTCCATTTCGCCGGTGTGGCTGGCATGAGCATTACTGAAGGTGTGCCACGTATCAAAGAGAT
CATCAACGCATCCAAGAAAATCAACACGCCGATCATCACGTGTCCGCTCCAGAACCCTCGTCAGATCGAAGCAGCGCACA
TTGTCAAGGGGCGCATCGAAAAGACTTACATCTCGGACGTCCTGAGTTATGTCGAAGAAGAATGGGACGGCAACGAAGGC
AGAATCATTATGAAGGTGGACCAGCAGGCATTGAATGACCTGCAACTGGGAGTCGGTCTTCATGATATTGCACTGTCTGT
TTGCAAGCAGAAGAAGCTAAAGATCGATGAGAACCTCGTGTTTGCCGACACTTTCGCAAGCACGATCACGATCATTGTTC
GCAACGGCGGGGCAGATTATGGGTCAAGGCGTTCTGCTGCAACCAAGGCAAAGGCCAGTGCGGACAACCAAGACCTGCTG
TTTCGCGTCAACTTCCTTCGCCGCCAGCTGCCTGCGATAGGAATTTCCGGCTACCCCGACGCTGCTCGCGCGGTGATCCA
AACGGAGAAAGACGAGCACACAGTGTACGTGGAAGGATACGGACTGCGGGAATGCATCAACACAGAAGGCGTCATTGGTA
CCGGTGTGGTGACTAACAGCATTATGGAATGTCTGGATATTCTCGGCATCGAAGCGGCCAGGAAGTCGATCGCCGTGGAA
ATCAAGAACGTGATGCGCGACATGAACATTGATCCGCGGCACATGGAGCTTCTCGCTGACGTCATGACGTACAAAGGCCA
AGTGCTTGGCATCACGCGCTTTGGTTTGGCCAAAATGCGGGACAGTGTTCTGCAGCTCGCCTCATTTGAGAAGACGCCTG
ACCATCTGTTCGATGCGGTTGCCGGACTGAAGGAGGATCCCATTCAAGGTGTCAGCGAGTCGGTCATTATGGGACAATCG
ATGAGCGTTGGTACTGGAGGATTTGGTATGATCCGGCGTCTAGGATTGCAGCCAGATGATTTTGCACCGCAGCAAACGGT
TTTCGAGGATGCATGGAATGCGACCATGAAGAAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62